compositions and methods for stabilizing active agents

专利摘要:
COMPOSITIONS AND METHODS FOR STABILIZING ACTIVE AGENTS.This document provides methods and compositions for stabilizing active agents. The active agents are distributed, mixed or encapsulated in a silk fibroin matrix, thereby retaining the bioactivity of the active agents during storage and / or transportation. In some embodiments, storage stable silk vaccine compositions are also provided herein.
公开号:BR112013027057A2
申请号:R112013027057-8
申请日:2012-04-23
公开日:2020-08-11
发明作者:David L. Kaplan；Fiorenzo Omenetto
申请人:Trustees Of Tufts College；
IPC主号:

专利说明:

"Descriptive report on the invention patent for:" COMPOSITIONS AND METHODS FOR STABILIZING ACTIVE AGENTS "
CROSS REFERENCE TO RELATED APPLICATIONS This claim claims the benefit under 35 USC s8119 (e) of US Provisional Application number 61 / 477,737, filed on April 21, 2011, which is incorporated into this document as a reference in its entirety.
APOTO DO GOVERNO This invention was made with the support of the Government under subsidies EBO002520 granted by the National Institutes of Health and FA9550-07-1-0079 granted by the US Air Force. The Government has certain rights over the invention.
TECHNICAL FIELD The present invention relates generally to methods and compositions for stabilizing active agents.
BACKGROUND The stabilization of active agents is a critical factor for many applications, because active agents are generally unstable and sensitive to changes in environmental conditions, for example, temperature, humidity and / or light. Even if an active agent is identified as being useful for a given reaction, its application is often hampered by a lack of long-term stability under process conditions.
Several ways to stabilize the active agents, for example, therapeutic enzymes and proteins, have been studied, from lyophilization to covalent immobilization in different applications. In general, many immobilized active agents demonstrate improved stability, probably due to reduced mobility to prevent changes in hydrophobic hydration and thus aggregation and loss of activity. Techniques for immobilizing active agents, for example, enzymes, generally grouped into four categories: (1) non-covalent adsorption of enzymes for transport to material surfaces, (2) covalent bonding to material surfaces, (3) physical entrapment within a material matrix, and (4) cross-linking of an enzyme to "block" the structure. All of these approaches are a compromise between keeping catalytic activity high while achieving the benefits listed above. The absence of materials that provide specific surface binding sites or relative hydrophilic / hydrophobic microenvironments for high load retention and the activity of active agents limits the application of the above carrier-based immobilization approaches. In addition, for many applications, carrier materials need to be biodegradable and biocompatible for biomedical applications, which excludes the use of most synthetic polymer materials.
Recently, new immobilization approaches have been developed to improve the stability and activity of the active agent, for example, enzymes. For example, the microenvironment of the support material can be manipulated by using blocking agents to reduce non-specific binding sites. Alternatively, hydrophilic macromolecules can be introduced close to the active agent, or hydrophilic spacers used between the active agent and the material surface. In addition, sol-gel materials have been used for immobilization and have been found to increase the activity of enzymes, for example, lipases, up to 100 times, due to the effects of microenvironmental confinement.
In addition, enzymatic cross-linking methods have been combined with protein crystallization to generate cross-linked enzyme crystals (CLECS) with increased enzyme stability and selectivity when compared to the native enzyme. Although this method has been used by pharmaceutical companies to formulate therapeutic protein drugs, protein crystallization is complicated and often unpredictable. Cross-linked enzyme aggregates (CLEAS) can be obtained by protein precipitation, followed by cross-linking with glutaraldehyde. The penicillin acylase CLEAs showed the same activity as a CLEC in ampicillin synthesis. Magnetic nanoparticles were also used for covalent immobilization of enzymes and thus improving the stability of the enzyme. However, none of these immobilization methods is biocompatible / biodegradable or simple to use, providing stability under environmental storage conditions (eg room temperature) for long periods of time.
In particular, stabilizing the vaccine has been a long-term challenge and large quantities of vaccines have been wasted due to inadequate storage. Although global immunization currently saves the lives of 2-3 million children each year, of the 10.5 million child deaths that occur annually, 2.5 million are due to diseases that can be prevented by vaccines. Measles, mumps and rubella are three common childhood diseases, caused by measles virus, mumps virus (paramyxoviruses) and rubella virus (togavirus), respectively, which can be associated with serious complications and / or death. For example, pneumonia and encephalitis are caused by measles. Mumps is associated with aseptic meningitis, deafness and orchitis; and rubella during pregnancy can cause congenital rubella syndrome in newborns of infected mothers. The impact of measles, mumps and rubella vaccination on the natural history of each disease in the US can be quantified by comparing the maximum number of measles, mumps and rubella cases reported in a given year before using the vaccine in relation to the number of cases of each disease reported in 1995. For measles, 894,134 cases reported in 1941, compared to 288 cases reported in 1995 resulted in a 99.97% decrease in reported cases; for mumps, 152,209 cases reported in 1968, compared with 840 cases reported in 1995 resulted in a 99.45% decrease in reported cases; and for rubella,
57,686 cases reported in 1969 compared to 200 cases reported in 1995 resulted in a 99.65% reduction.
Monthly Immunization Table, 45 MMWR 24 (1996). Vaccines are biological substances that can lose their effectiveness quickly if they are overheated or cooled, especially during transport and storage. Unintentional freezing, heating above 8 ° C, or other breaks in the cooling chain can result in a lack of efficacy or waste of the vaccine. According to the WHO, between 2006-2015, the US will have contributed $ 35 billion to global vaccination programs. About a third will be spent on vaccines and the remainder will be spent on vaccine delivery systems. It is clear that even 1% of vaccine waste due to failure of the cooling chain is a considerable sum. In fact, for five states in the United States, the average waste of 1% to 5% costs about 6 to 31 million US dollars. In other parts of the world, vaccine waste can reach 10%. The two most common forms of waste relate to thermal stability and shelf life, with inadvertent freezing remaining as another "major problem. Thus, there is a great need for storage-stable active agents, for example, storage-stable vaccines, with longer service life that can maintain effectiveness in various adverse environmental conditions, for example, without the need to adapt the cooling chain.
SUMMARY Several modalities described in this document provide a storage-stable composition comprising a matrix of silk fibroin and an active agent distributed therein, in which the active agent retains at least about 30% of its original bioactivity when the composition is submitted, at least one cycle of change of state and / or is maintained for a period of time in a condition of cycle change state, and / or is maintained for a period of time, under a specified condition.
In one embodiment, the state change cycle is a freeze-thaw cycle.
In one embodiment, the period of time to keep the agent active is at least about 24 hours.
In some embodiments, the indicated condition may be an environmental condition according to which an active agent is stored and / or transported.
Non-limiting examples of environmental conditions include temperatures, air pressures, humidity and exposure to light.
In some embodiments, the active agent is an immunogen.
In some embodiments, the active agent is a vaccine.
Distribution kits and devices, for example, useful in the biomedical field, are also provided in this document.
Examples of delivery devices include, but are not limited to, syringes, dry powder injectors, nasal sprays, nebulizers, and implants.
Such kits and devices comprise “a storage-stable composition described herein and, optionally, a pharmaceutically acceptable solution.
In one embodiment, the kit further includes at least one dispensing device for administering to an individual a storage-stable composition described herein and / or a disinfectant.
BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the linear relationship between the dilution of the vaccine sample log and Ct values for measles, mumps and rubella.
Error bars N = 3 represent standard deviations.
Figure 2 shows the results of the MMR vaccine reconstituted in 24, 18, 12 and 6 hours in water, before inoculation, protected from light, of the cells stored at 25ºC.
Error bars N = 3 represent standard deviations.
Figure 3 shows the stability of the measles, mumps and rubella virus stored in 9% (weight / volume) of silk films for more than 3 months.
Error bars N = 3 represent standard deviations.
Figure 4 is a bar graph that compares the initial potency recovered from measles, mumps and rubella viruses in silk films with the addition of MgCl2, MgSOs and sucrose stabilizing additives.
Error bars N = 3 represent standard deviations.
Figure 5 shows the MMR vaccine reconstituted at 24, 18, 12 and 6 hours in 70% sucrose before inoculation, protected from light, of the cells stored at 25ºC.
Error bars N = 3 represent standard deviations.
Figures 6A-6D show comparisons of the residual potency of the MMR vaccine reconstituted in water at 4ºC (figure 6A) or 37ºC (figure 6C), or 70% sucrose at 4ºC (figure
6B) or 37ºC (figure 6D). The vaccines were reconstituted at 24, 18, 12 and 6 hours in water or 70% sucrose before inoculation, protected from light, of the cells stored at 25ºC.
Error bars N = 3 represent standard deviations.
Figure 7 shows a schematic of the manufacture of silk films that encapsulate the vaccine and effectiveness test. (1) Freeze-dried vaccine powder is reconstituted in an aqueous sterile silk solution. (2a) The silk films that encapsulate the vaccine were prepared by melting an aliquot of the vaccine-silk mixture on a Teflon-coated surface and allowed to dry in a sterile chamber for 12 hours at room temperature, protected from light. (2b) The individual dry films were stored in Eppendorf tubes at temperatures suitable for stability studies. (3a) After being lyophilized, the vaccine powder was reconstituted in sterile aqueous silk solution, the silk films that encapsulate the lyophilized vaccine were prepared by molding an aliquot of the vaccine-silk mixture into a 96-well and lyophilized plate. (3b) The individual lyophilized films were removed from the well plate and transferred to glass serum bottles, sealed with a lyophilization stopper and aluminum seal under nitrogen and vacuum conditions. (4) For infectiousness studies, the films were redissolved in sterile water free from nuclease and the solution was added directly to Vero cells grown in M199 media grown in a 24-well plate. The cells were incubated for 3 days to allow the virus to replicate, then the RNA was isolated, converted to DNAC and quantified by real-time PCR. (5) RNA was isolated from Vero cells using Trizol / chloroform, the RNA was purified and reverse transcription was performed to synthesize DNAC for RT-PCR in real time.
Figures 8A-8C show graphs of the residual potency of the components of the measles, mumps and rubella virus of the lyophilized vaccine reconstituted in water for different periods of time, stored at 4ºC (figure 8A), 25ºC (figure 8B) and 37ºC (figure 8C ) (+) measles, (0) mumps, (NM) rubella, error bars N = 3 represent standard deviations.
Figures 9A-9D show graphs of the stability of the measles virus component of the MMR vaccine stored in 9% silk films (weight / volume) for more than 6 months at 4ºC (figure 9A), 25ºC (figure 9B), 37ºC (figure 9C), and 45ºC (figure 9D). (+) MMR on silk films, (O) MMR powder, error bars N = 3 represent standard deviations.
Figures 10A-10D show graphs of the stability of the mumps virus component of the MMR vaccine stored in 9% silk films (weight / volume) for more than 6 months at 4ºC (figure 10A), 25ºC (figure 10B), 37ºC (figure 10C), and 45ºC (figure 10D). (+) MMR on silk films, (D) MMR powder, error bars N = 3 represent standard deviations.
Figures 11A-11D show graphs of the stability of the rubella virus component of the MMR vaccine stored in 9% silk films (weight / volume) for more than 6 months at 4ºC (figure 11A), 25ºC (figure 11B), 37ºC (figure 11C), and 45ºC (figure 11D). (+) MMR in silk films, (OD) MMR in powder, error bars N = 3 represent standard deviations.
Figures 12A-12D show graphs of the stability of the measles virus component of the MMR vaccine stored in 9% lyophilized silk films (weight / volume) for more than 6 months at 4ºC (figure 12A), 25ºC (figure 12B) , 37ºC (figure 12C), and 45ºC (figure 12D). (+) MMR in lyophilized silk films, (OD) MMR in powder, error bars N = 3 represent standard deviations.
Figures 13A-13D show graphs of the stability of the measles virus component of the MMR vaccine stored in 9% lyophilized silk films (weight / volume) for more than 6 months at 4ºC (figure 13A), 25ºC (figure 13B) , 37ºC (figure 13C), and 45ºC (figure 13D). (+) MMR in lyophilized silk films, (DO) MMR in powder, error bars N = 3 represent standard deviations.
Figures 14A-14D show graphs of the stability of the MMR vaccine rubella virus component stored in lyophilized silk films at 9% (weight / volume) for more than 6 months at 4ºC (figure 14A), 25ºC (figure 14B), 37ºC (figure 14C), and 45ºC (figure 14D). (+) MMR in lyophilized silk films, (O) MMR in powder, error bars N = 3 represent standard deviations.
Figures 15A-15C show Arrhenius graphs of the degradation rates of the components of vaccine for measles (figure 15a), mumps (figure 15B) and rubella (figure 15C), as a function of the inverse of absolute temperature. (+) Lyophilized silk films, silk films (0), (W) powder.
Figures 16A-16C show graphs of the expected half-lives of the viral components of measles (figure 16º), mumps (figure 16B) and rubella (figure 16C) as a function of temperature and the corresponding upper and lower limits of half-life. The predicted half-lives represent the estimated time required for the viral component to degrade to 50% of the initial value. (+) Lyophilized silk films, silk films (0), (NM) powder.
Figure 17 shows a graph of the differential scanning calorimetry, DSC, in solid state. Solid state DSC of a lyophilized silk film shows glass transition (Tg) at 178ºC. The manufacturer's Tg supplied powder MMR vaccine (containing a wide variety of excipients and stabilizers) as 68.9ºC.
MMR in lyophilized silk films showed a Tg of 89.2ºC, indicating that the addition of silk to powder MMR increased the stability of the vaccine reflected in the increase in Tg.
The MMR curve in lyophilized silk film, however, showed two peaks at 116.6ºC and 164.8ºC, which could indicate a Tm and Td, describing the unfolding or degradation of the vaccine components.
Figure 18 shows a graph of the differential exploratory nano calorimetry, nano-DSC.
The Tm of purified viral particles appears around 16.8ºC.
The presence of silk increases the Tm of the viral particles to 68.3ºC.
The sharp drop following Tm is an exothermic event most likely due to aggregation, as a result of the protein split in Tm.
The silk Tg was around 178ºC, so the high Tg values were due to the effect of silk on encapsulated viral proteins.
Figure 19 shows a graph indicating the comparison of the dynamic light scattering of viral particles purified in water and viral particles purified in silk solution.
The average effective diameter of the viral particles of the MMR was about 250 nm.
The average effective diameter of the purified MMR solution started to increase by about 16ºC, indicating the aggregation of viral particles, due to the increase in thermal power. The MMR silk solution showed no signs of aggregation up to 70ºC, indicating that silk provided structural stability to prevent the aggregation of viral proteins.
Figures 20A-20B show MMR release graphics (figure 20-A) of silk films and (figure 20B) lyophilized silk films. Error bars N = 3 represent standard deviations.
Figures 21A-21B show graphs (figure 21A) of the release of MMR hydrogels on silk and silk microspheres (figure 21B). Error bars, N = 3 represent standard deviations.
Figures 22A-22D show schematic diagrams. In figure 22A, mumps and saranops belong to the Paramyxoviridae family and their structures consist of negative sense, single-stranded RNA encapsulated in nucleocapsids within a lipid bilayer. The viral envelope is formed by the matrix protein (M), hemagglutinin protein (H) and fusion protein (F). Structurally intact H and F proteins are the proteins responsible for binding and fusing viral particles to animal cells. In figure 22B, by a combination of hydrophobic interaction and limited chain mobility, the trapped silk viral particles maintain structural activity at elevated temperatures. In figure 22C, proteins F and H bind to CD46 and CD150 receptors (collectively known as SLAM) to enter cells in order to initiate viral replication. In figure 22D, denaturation of surface proteins can cause aggregation of the viral particles. Disturbance of proteins can prevent them from being recognized by the cell and entry is denied.
DETAILED DESCRIPTION It should be understood that this invention is not limited to the specific methodology, protocols and reagents, etc., described in this document and as such, it may vary. The terminology used in this document is intended to describe only specific modalities, and is not intended to limit the scope of the present invention, which is defined exclusively by the claims.
As used in this document and in the claims, singular forms include reference to the plural and vice versa, unless the context clearly indicates otherwise. Except in operational examples or where otherwise indicated, all numbers that express quantities of ingredients or reaction conditions used in this document are to be understood as modified in all cases by the term "about".
All patents and other identified publications are expressly incorporated into this document as a reference, for the purpose of describing and revealing, for example, the methodologies described in such publications that can be used in connection with the present invention.
These publications are provided solely for your disclosure prior to the filing date of this application.
Nothing in this regard should be interpreted as an admission that inventors have no right to anticipate disclosure by virtue of prior invention or for any other reason.
All statements regarding the date or representation regarding the content of these documents are based on the information available to depositors and do not constitute any admission as to the accuracy of the dates or content of these documents.
Unless otherwise stated, all technical and scientific terms used in this document have the same meaning as those normally understood by one versed in the common technique to which this invention belongs.
Although any known methods, devices and materials can be used in the practice or experiment of the present invention, the related methods, devices and materials are described herein.
One aspect provided in this document refers to methods and compositions for maintaining or stabilizing the bioactivity of an active agent. The method includes maintaining a composition, in which the composition comprises a matrix of silk fibroin, and at least one active agent distributed, mixed, or integrated with it and in which at least one active agent stabilizes or retains at least , for about 30% of its original bioactivity when the composition is subjected to a specified condition, which inhibits or reduces the bioactivity of the active agent, for a period of time. These conditions may include, but are not limited to, a cycle of change of state, temperatures, air pressures, humidity and exposure to light. In one embodiment, the state change cycle is a freeze-thaw cycle.
The modalities of the various aspects described in this document provide stabilized active agents, where the stabilization of an active agent is achieved through the distribution, mixing, or incorporation of an active agent into a silk fibroin matrix. The silk fibroin matrix can be a silk fibroin solution or a solid silk fibroin matrix. This approach provides that the active agent maintains bioactivity, regardless of the cooling chain and / or environmental conditions in which the active agent is stored and / or transported. Exemplary environmental conditions include, but are not limited to, temperatures, air pressures, humidity and exposure to light. For example, the cooling chain is standard practice for stabilizing active agents in the pharmaceutical industry: maintaining the cooling chain ensures that active agents are transported and stored within the manufacturer's recommended temperature range (for example, 2ºC at 8ºC or below freezing temperatures), until use.
In certain embodiments, the active agents described in this document are immunogenic. In one embodiment, the immunogen is a vaccine. Most vaccines are sensitive to the “environmental conditions in which they are stored and / or transported. For example, freezing can increase reactogenicity (for example, the ability to cause an immune reaction) and / or loss of potency for some vaccines (for example, HepB, DTaP / IPV / HIB), or cause cracks in the container, leading to contamination. In addition, some vaccines (eg BCG, chickenpox, and MMR) are sensitive to heat. Many vaccines (for example, BCG, MMR, chickenpox, meningococcal C conjugate, and most vaccines containing Tdap) are sensitive to light. See, for example, Galazka et al., Thermostability of vaccines, in Global Program for Vaccines & Immunization (World Health
Organization, Geneva, 1998); Peetermans et al., Stability of freeze-dried rubella virus vaccine (Cendehill strain) at various temperatures, I J.
Biological Standardization 179 (1973). Thus, the compositions and methods described in this document also provide stabilization of vaccines regardless of the cooling chain and / or other environmental conditions.
Stabilization of Active Agents the terms "stabilization", "stabilize", and "stability" are used in this document with reference to maintaining or retaining the bioactivity of at least one active agent in a silk fibroin matrix.
The term "active stabilizing agents", as used herein, means that one or more active agents distributed, mixed or incorporated into a silk fibroin matrix retain at least about 30% of its original bioactivity, including at least at least, about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% of its original bioactivity or more.
The terms "stabilize" and "maintain" with reference to the bioactivity of active agents are used interchangeably in this document.
As used herein, the terms
"maintain", "maintain" and "maintenance", when referring to compositions or active agents means to maintain, sustain or retain the bioactivity of at least one active agent in a silk fibroin matrix, when the active agent is subjected to certain conditions. In some embodiments, one or more active agents, distributed in a matrix of silk fibroin, retains at least about 30% of its original bioactivity, including at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% of its original bioactivity or more.
The term "bioactivity", as used in this document with reference to an active agent, in general, refers to the ability of an active agent to interact with a biological target and / or to produce an effect on a biological target. For example, bioactivity may include, without limitation, eliciting a stimulating, inhibitory, regulatory, toxic or lethal response to a biological target. The biological target can be a molecule or a cell. For example, a double activity can refer to the ability of an active agent to modulate the effect / activity of an enzyme, block a receptor, stimulate a receptor, modulate the level of expression of one or more genes, modulate cell proliferation, modulate cell division, modulate cell morphology, or any combination of these. In some cases, bioactivity may refer to a compound's ability to produce a toxic effect in a cell.
Bioactivity can be determined by analyzing a cellular response. Exemplary cellular responses include, but are not limited to lysis, apoptosis, growth inhibition and growth promotion; production, secretion and exposure of the surface of a protein or other molecule of interest to the cell; activation of the membrane surface molecule including activation of the receptor; ion transport from the transmembrane; transcriptional regulations; changes in cell viability, changes in cell morphology, changes in the presence or expression of an internal cell component; changes in the presence or expression of a nucleic acid produced within the cell; changes in the activity of an enzyme produced within the cell; and changes in the presence or expression of a receptor. Methods for assaying different cellular responses are well known to one skilled in the art, for example, western blot to determine changes in the presence or expression of an endogenous cell protein, or microscopy to control cell morphology, in response to the active agent. With reference to an antibody, the term "bioactivity" includes, but is not limited to, the affinity of binding to the epitope or antigen, the in vivo and / or in vitro stability of the antibody, the immunogenic properties of the antibody, for example, when administered to a human individual, and / or the ability to neutralize or antagonize the bioactivity of a target molecule in vivo or in vitro.
The above properties or characteristics can be observed or measured using techniques recognized in the art, including, but not limited to, scintillation proximity assays, ELISA, ORIGEN immunoassays (IGEN), fluorescence saturation, fluorescence ELISA, competitive ELISA, SPR, including but not limited to SPR analysis using a BIAcore biosensor, in vitro and in vivo neutralization assays (see, for example, International Publication No.
WO 2006/062685), receptor binding, and immunohistochemistry with tissue sections from different sources, including human, primate, or any other source as needed.
With reference to an immunogen, "bioactivity" includes immunogenicity, the definition of which is discussed in detail below.
With reference to a virus, "bioactivity" includes infectiousness, the definition of which is discussed in detail below.
With reference to a contrast agent, for example, a dye, "bioactivity" refers to the ability of a contrast agent when administered to an individual to increase the contrast of structures or fluids within the individual's body. The bioactivity of a contrast agent also includes, but is not limited to, its ability to interact with a biological environment and / or influence the response of another molecule under certain conditions.
The term "original bioactivity", with reference to an active agent, generally means the bioactivity of an active agent when measured immediately before or immediately after theThe active agent is introduced into a silk fibroin matrix. That is, the original bioactivity of an active agent can be measured, for example, within approximately 20 minutes, before or after the active agent is introduced into a silk fibroin matrix. In some cases, the initial bioactivity of an active agent can be measured, for example, for about 10 seconds, about 15 seconds, about 20 seconds, about 25 seconds, about 30 seconds, about 1 minute, about about 2 minutes, about 3 minutes, about 4 minutes, about 5 minutes, about 6 minutes, about 7 minutes, about 8 minutes, about 9 minutes, about 10 minutes, about 11 minutes, about 12 minutes, about 13 minutes, about 14 minutes, about 15 minutes, about 16 minutes, about 17 minutes, about 18 minutes, about 19 minutes, or about 20 minutes, before or after the agent active be introduced into a silk fibroin matrix.
In one embodiment, the silk fibroin matrix is a solid-state silk fibroin matrix.
In such a modality, an active agent may lose some of its bioactivity during handling before being distributed in a matrix of silk fibroin in solid state.
In another embodiment, the term "original bioactivity", as used in this document, can be used to describe the bioactivity of an active agent before the active agent is introduced into a silk fibroin matrix. In some embodiments, the term "bioactivity original "refers to the maximum bioactivity of an active agent, for example, the bioactivity measured immediately after activation of the active agent, for example, by reconstitution, or by increasing the temperature.
For example, if the active agent is initially powdered, the active agent's initial bioactivity can be measured immediately after reconstitution.
In some embodiments, the term "original bioactivity" refers to the bioactivity of an active agent when stored or transported, in the absence of a silk fibroin matrix under the conditions specified by the manufacturer.
In some embodiments, the term "original bioactivity" refers to the bioactivity of an active agent when stored or transported in a storage-stable composition, as described in this "document, under the conditions specified by the manufacturer. The definitions of the term "original double activity" described in this document are also applied to the terms "original immunogenicity" and "original infectivity" as used herein.
According to the methods described in this document, the distribution, mixing or incorporation of an active agent in a silk fibroin matrix retains or stabilizes the bioactivity of the active agent, for example, at least about 30% of its initial bioactivity, regardless of environmental or storage conditions (for example, cycles of change of state, temperature, humidity or exposure to light). The silk fibroin matrix can be a solution or in solid form. In various embodiments, when an active agent is distributed in a silk fibroin matrix, that composition undergoes a cycle of change of state and / or is maintained for a period of time, under a specified condition, the active agent may retain at least about 30% of its original bioactivity is, for example, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95% of the original bioactivity or more. In one embodiment, the active agent can retain at least about 80% of its initial bioactivity. Put another way, the stability of an active agent in a silk fibroin matrix (that is, the ability of an active agent to maintain its bicactivity (for example, at least about 30% of its initial bioactivity) in a silk fibroin matrix) can be increased by at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, with respect to the stability of an active agent in the absence of a silk fibroin matrix. In one embodiment, the active agent can retain at least about 80% of its initial bioactivity.
The compositions described in this document can be maintained for any period of time, for example, hours, days, weeks, months or years. In some embodiments, the compositions described in this document can be maintained at a temperature above 0ºC for at least about 3 hours, at least about 6 hours, at least for about 9 hours, at least for about 12 hours hours at least for about 24 hours or more. In some embodiments, the compositions described in this document can be kept for at least about 1 day,
at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least for about 7 days or more. In some embodiments, the compositions described in this document can be kept for at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about four weeks or more. In some embodiments, the compositions described in this document can be kept for at least about 1 month, at least for about 2 months, at least about 3 months, at least about 4 months, at least about 5 months , at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, at least about 12 months, or more.
In the methods and compositions described in this document, the described compositions can be maintained at any temperature or at a manufacturer recommended temperature specified for an active agent. In some embodiments, the compositions can be kept in liquid nitrogen or dry ice. In some embodiments, the compositions can be kept, for example, between about -80ºC and about -20ºC, inclusive, or between about -20ºC and about 0ºC, inclusive. In some embodiments, the compositions can be kept at a temperature above 0ºC. In these embodiments, the compositions can be kept at a temperature of about 0 ° C to about room temperature. As used herein, the term "room temperature" is used to describe a temperature around which the compositions described in this document are maintained and includes temperatures between 0 ° C and 60 ° C, between 0 ° C and 50 ° C, or between 0 ° C and 40 ° C. In some modalities, the room temperature is the temperature of the refrigerator (for example, between 0ºC and 15ºC, inclusive). In some embodiments, the ambient temperature is around an individual's body temperature (for example, between 36ºC and 38ºC, inclusive, for a human individual, or a range of higher or lower body temperatures for other animals). In some modalities, the room temperature is the room temperature, for example, between 20ºC and 35ºC, and can vary according to the geographical conditions.
For example, the ambient temperature in regions with a hot climate, for example, in Africa, can generally be warmer than in regions with a cold climate, for example, the United States or the United Kingdom. In some embodiments, the compositions can be maintained at a temperature of at least about 37 ° C or more at 37 ° C. In some embodiments, the compositions can be kept at a temperature of at least about
40ºC or more at 40ºC.
In some embodiments, the compositions can be kept at a temperature of at least about
45ºC or more at 45ºC.
Some modalities described in this document are useful for the development of implantable devices for drug delivery, in which an active agent can retain at least 30% (including at least about 40%, at least about 60%, at least less about 80% or more) of its original bioactivity or more over a period of time.
In some embodiments, a composition or an active agent in an implantable drug device may retain at least about 30% of its original bioactivity or more for at least about 6 hours, at least about 12 hours, at least about 24 hours, at least about 36 hours, at least about 48 hours, at least 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about a week, at least about two weeks, at least about three weeks, at least, about 4 weeks, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least at least about 6 months, or at least after 1 year or more, after implantation.
In some embodiments, one or more active agents, for example, immunogens such as vaccines, encapsulated in an injectable form of silk fibroin matrix (for example, but not limited to hydrogel, gel-like particles, and / or microspheres) may be administered to an individual (for example, by injection, such as subcutaneous injection), as a deposit of active agent (for example, a deposit of vaccine) such that The active agent (for example, a vaccine) can be released continuously or intermittently, from the deposit for an extended period of time, for example, for a period of hours, days, weeks or months.
In some embodiments, the active agent (for example, a vaccine) can be released at a rate at which at least about 1% (including at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least at least about 90%, at least about 95%, or more) of the encapsulated active agent is released over a period of at least 1 hour, at least 2 hours, at least 3 hours, at least about 4 hours, at least about 5 hours, at least about 6 hours, at least about 12 hours, at least about 24 hours or more.
In some embodiments, the active agent (for example, a vaccine) can be released at a rate at which at least about 10% (including at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95% or more ) of the encapsulated active agent are released over a period of 5 days, over a period of 1 week, at least about 2 weeks, at least about 3 weeks, at least about 1 month, at least for about 2 months at least about 3 months or more.
In some embodiments, the active agent retains at least about 30% of its original bioactivity, for example, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95% of the original bioactivity or higher activity at about 4ºC, about 25ºC, about 37ºC, about 45ºC, or more, for at least up to 6 months.
In some embodiments, the active agent retains at least about 8% of the initial bioactivity at temperatures of around 37ºC or more, for at least 6 months.
In some embodiments, the compositions described in this document can be maintained under exposure to light, for example, light of different wavelengths and / or from different sources.
In some embodiments, the compositions described in this document can be kept exposed to UV or infrared radiation. In some embodiments, the compositions described in this document can be kept under visible lights.
In some embodiments, the composition described in this document, when stored or transported, may be subjected to at least one cycle of change of state.
The term "cycle of change of state" as used herein refers to a change from a state of matter, including, but not limited to, from a solid to a liquid state, or from a fluid state to a solid state. A fluid state can include, but is not limited to, liquids, gases, pastes, slurry, plasmas, and any combinations thereof.
A solid state refers to a state that is not fluid and can also include semisolids, for example, a gel. The composition described in this document can be maintained in a given state for any period of time, for example, seconds, minutes, hours, weeks, months or years, before moving to another state. A state change cycle can result from at least a change in an environmental condition described in this document, for example, a change in temperature, a change in ambient air pressure, light conditions, humidity, or any combination the same.
In one embodiment, the state change cycle refers to a freeze-thaw cycle.
In such embodiments, the composition described in this document, when stored or transported, may be subjected to at least one freeze-thaw cycle, at least two freeze-thaw cycles, at least three freeze-thaw cycles, at least four freeze-thaw cycles, at least five freeze-thaw cycles, at least six freeze-thaw cycles, at least seven freeze-thaw cycles, at least eight freeze-thaw cycles, at least nine freeze-thaw cycles , at least,
ten freeze-thaw cycles or more.
The term
"freeze-thaw cycles" is used in this document to describe an alternating series of freezing and thawing, and also encompasses an alternating series of frozen (solid) and fluid states.
For example,
a freeze-thaw cycle involves a change of state between a frozen (solid) state and a fluid state.
The time interval between freezing and thawing, or frozen and liquid state, can be any length of time, for example, hours, days, weeks or months.
For example, once an active agent composition has been frozen or in a frozen state, it can be continuously stored in the frozen state at temperatures below freezing, for example, between about -20ºC and -80ºC, until need to be defrosted for use again. The freezing of a composition can be carried out quickly, for example, in liquid nitrogen, or gradually, for example, at a freezing temperature, for example, between about -20ºC and -80ºC. Defrosting a frozen composition can be carried out at any temperature above 0ºC quickly, for example, at room temperature, or gradually, for example, on ice. Typically, an active agent in the fribroin matrix other than silk can lose its bioactivity over one or more freeze-thaw cycles. As described in the present document, the distribution of an active agent in a silk fibroin matrix can increase the stability of the active agent and thus retain its bioactivity, during one or more freeze-thaw cycles.
In some embodiments, the compositions described in this document can be maintained at a relative humidity of at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50% or more. The term "relative humidity" as used herein is a measure of the amount of water vapor in a mixture of air and water vapor. It is generally defined as the partial pressure of water vapor in the air-water mixture, given as a percentage of the saturated vapor pressure under these conditions.
In some embodiments, the compositions described in this document can be lyophilized to reduce residual moisture during storage. In some embodiments, the residual humidity is reduced by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50 %, at least about 60%, at least about 70%, at least about 80%, at least about 90% or at least about 95%.
In some embodiments, the compositions described in this document can be kept under or subjected to any type of air pressure. In some embodiments, the compositions described in this document can be kept under or subjected to around atmospheric pressure, or more, for example, about 1 atm, about 2 atm, about 3 atm, about 4 atm, about 5 atm, about 6 atm, about 7 atm, about 8 atm, about 9 atm or about 10 atm. In some embodiments, the compositions described in this document can be kept under or subjected to a vacuum. In one embodiment, the composition is maintained under two or more conditions specified in this document.
Without wishing to be bound by theory, silk can reduce the rate of degradation of an immunogen (eg, vaccine), at an elevated temperature (eg, at room temperature or above, including at least about 20 ° C, at least least about 30ºC, at least about 40ºC or more). Thus, an immunogen (eg, vaccine) distributed in a silk fibroin matrix can have a longer half-life at an elevated temperature (eg, at room temperature or above, including at least about 20 ° C, at least about 30ºC, at least about 40ºC or more) at least, about 1.5 times (for example, at least about 2 times, at least about 3 times, at least about 4 times, at least at least about 5 times, at least about 10 times, at least about 15 times, at least about 20 times, at least about 25 times, at least about 30 times, or more), in relation to an immunogen , without the silk matrix. As used herein, the term "half-life" refers to the time in which an agent retains about 50% of its initial bioactivity (including original immunogenicity or initial infectivity). Consequently, a method for extending the half-life of an immunogen (for example, vaccine), for example, at an elevated temperature (for example, at room temperature or above, including at least about 20 ° C, at least about 30ºC, at least about 40ºC or more) is also provided in this document. The method "comprises maintaining an immunogenic composition, in which the composition comprises a matrix of silk fibroin, and at least one immunogen (for example, vaccine) distributed therein, and in which the immunogen (for example, vaccine) retains at least about 30% of its initial immunogenicity (for example, infectivity) when the composition is maintained for at least about 24 hours at a temperature of at least around room temperature or more. the immunogen (eg vaccine) can retain at least about 80% of its initial immunogenicity (eg infectivity). In some embodiments, the composition can be maintained for at least up to about 6 months. The composition can be kept at a temperature above 37ºC, above 45ºC, or higher.
Stable storage compositions Other aspects described in this document are the storage stable compositions that comprise a silk fibroin matrix and an active agent distributed, mixed or incorporated into it, in which the active agent retains at least about 30% of its original bioactivity when the composition is subjected to at least one cycle of change of state, and / or is maintained for a period of time, under one or more of the conditions specified in this document.
In one embodiment, the state change cycle is a freeze-thaw cycle.
In one embodiment, the time period for keeping the agent active is at least about 24 hours.
In some embodiments, the indicated condition may be an environmental condition under which an active agent is stored and / or transported.
Non-limiting examples of environmental conditions include temperatures, air pressures, humidity and exposure to light.
In some embodiments, the compositions described in this document may be immunogenic.
In such embodiments, the active agent is an immunogen.
In some embodiments, the active agent is a vaccine.
Any compositions described in this document can be present in any state of matter, for example, a film, a fiber, a particle, a gel, a microsphere or a hydrogel.
In the various embodiments, the material condition of the compositions described in this document may vary according to the condition of the fibroin matrix,
for example, a film, a fiber, a particle, a gel, a microsphere, or a silk hydrogel. In some embodiments, the silk fibroin matrix is present in a solid state. In other embodiments, the silk fibroin matrix may be a solution.
Any ratio of active agent silk fibroin can be used. In the various embodiments, the ratio of an active agent's silk fibroin matrix is from about 1: 1,000 to about 1,000, 1: about 1: 500 to about 500: 1, about 1: 250 to about 250: 1, about 1: 125 to about 125: 1, about 1: 100 to about 100: 1, about 1:50 to about 50: 1, about 1:25 to about 25: 1, about 1:10 to about 10: 1, about 1: 5 to about 5: 1, about 1: 3 to about 3: 1 or about 1: 1. The ratio of the silk fibroin matrix to the active agent can vary according to a number of factors, including the selection of an active agent, the condition of storage, and duration, the concentration of the silk fibroin matrix and the shape of the silk matrix. One skilled in the art can determine the appropriate ratio of the silk fibroin matrix to the active agent, for example, by measuring the bioactivity of the active agent maintained for the various reasons described in this document over a predetermined amount of time, under a defined condition, for example, at a temperature above 0ºC.
The methods for measuring the bioactivity of the various active agents described in this document, for example, enzymes, vaccines, proteins, antibodies and nucleic acids, are well known in the art.
For example, the stability or bioactivity of a given active agent in silk fibroin can be determined based on the combination of time and temperature.
For example, stabilization studies can be conducted for 6 months.
Activity tests can be carried out, for example, after 2 weeks, 4 weeks, and then monthly.
Samples can be prepared to provide N = 3 for each time point.
The range of storage temperature conditions to be assessed includes 4ºC (refrigeration), 25ºC (room temperature), 37ºC (body temperature), 45ºC and / or 50ºC, inclusive.
In addition, the activity can be tested after one, two, three or more freeze-thaw cycles.
These variables can be combined exhaustively to fully characterize the optimal formulation for the long-term stability of the active agent (s). In some embodiments, the results of the stability of the active agent with respect to silk can be compared, for example, with the preparations of lyophilized active agent in the same storage conditions, in order to improve the stability of the storage conditions recommended by the manufacturer ( eg 4ºC) of lyophilized active agent preparations. When the silk fibroin matrix is in a solid state, it can be further processed. In some embodiments, compositions comprising a solid-state silk fibroin matrix can be further micronized. The term "micronized" is used in this document to refer to particles with an average size of about 1,000 pum or less and encompass nanoparticles and / or microparticles. As used herein, the term "nanoparticles" is defined as particles with an average size between about 1 nm to about
1,000 nm, from about 5 nm to about 900 nm, or from about 10 nm to about 800 nm. The term "microparticles" refers to particles with an average size ranging from about 1 µm to 1000 µm, from about 5 µm to about 900 µm or from about 10 µm to about 800 µm. It should be understood that "micronized" does not refer only to particles that have been produced by fine division, such as, mechanical grinding, tri-grinding or jet collision, of materials that are in volume form or other form, for example, a solid state dry fibroin film. In some embodiments, the micronized particles can also be formed by other mechanical, chemical or physical methods known in the art, such as, for example, formation in solution or in situ.
The composition described in this document can be micronized, for example, by spraying, crushing, grinding, lyophilizing, or any combination thereof.
Silk fibroin
Silk fibroin is a specifically attractive candidate biopolymer to be used in modalities of the various aspects described in this document, for example, because of all its aqueous processing (Sofia et al., 54 J.
Biomed.
Mater.
Res. 139 (2001); Perry et al., 20 Adv.
Mater. 3070-72 (2008)), relatively easy functionalization (Murphy et al., 29 Biomat. 2829-38 (2008)), and biocompatibility (Santin et al., 46 J.
Biomed.
Mater.
Res. 382-9 (1999)). For example, silk was approved by the U.S.
Food and Drug Administration as a tissue that builds a platform on human implants.
See Altman et al., 24 Biomaterials: 401 (2003). Silk can provide an immobilization matrix capable of stabilizing bioactive molecules.
Previous reports on the trapping of enzymes, antibodies and antibiotics in silk matrices indicate stabilization and activity recovered even at elevated temperatures and without special storage conditions or addition of additives (Pritchard et al., “Silk fibroin encapsulated powder reservoirs for sustained release of adenosine ”Journal of Controlled Release (2010) 144: 159-167; lu and others,“ Stabilization of enzymes in silk films ”Biomacromolecules (2009) 10: 1032-1042). However, these reports do not describe that silk fibroin can stabilize the vaccine (for example, a live vaccine) which is a biological preparation and is sensitive to temperature.
As used herein, the term "silk fibroin" includes silk fibroin and insect or spider silk protein.
See, for example, Lucas et al., 13 Adv.
Protein Chem. 107 (1958). Any type of silk fibroin can be used according to the various aspects described in this document.
Silk fibroin produced by silkworms, such as Bombyx mori, is the most common and represents an ecologically correct, renewable resource.
For example, the silk fibroin used in a silk film can be achieved by extracting sericin from the cocoons of B. mori.
Organic cocoons from the headquarters animals are also commercially available.
There are many different silks, however, including spider silk (for example, obtained from Nephila clavipes), transgenic silks, genetically modified silks, such as bacterial, yeast, mammalian cells,
transgenic animals or transgenic plants (see, for example, WO 97/08315, US Patent number 5,245,012) and its variants, which can be used.
In many embodiments, the silk fibroin matrix can be modified for different biomedical applications.
For example, to maintain the stability of an active agent distributed in a silk fibroin matrix, when implanted in vivo for tissue engineering or for drug distribution purposes, silk particles can be genetically modified, which predicts a new modification of silk, such as the inclusion of a fusion polypeptide comprising a fibrous protein domain and a mineralization domain, which can be used to form an organic-inorganic composite.
See WO 2006/076711. In addition, the silk matrix can be combined with one or more biocompatible polymers, such as polyethylene oxide, polyethylene glycol, collagen, fibronectin, keratin, polyaspartic acid, polylysine, alginate, chitin, chitosan, hyaluronic acid and the like.
See, for example, WO 04/062697, WO 05/012606. In some embodiments, silk fibroin can also be chemically modified, for example, through diazonium or carbodiimide coupling reactions, the interaction of avidin-biodine, or the modification of genes and the like, to alter the physical properties and functionality of silk protein. See, for example, WO 2011/011347, Functionalization of Silk Material by Avidin-Biotin Interaction; WO 2010/057142, Surface Modification of Silk Fibroin Matrices with PEG Useful as Anti-Adhesion Barriers & Anti-Thrombotic Materials; document US serial number 12 / 192,588, Diazonium Salt Modification of Silk Polymer. In addition, the silk fibroin matrix can be combined with a chemical substance, such as licerol, which affects, for example, the flexibility of the matrix, See, for example, WO 2010/042798, Modified Silk films Containing Glycerol.
Active agents As used in this document, the term "active agent" refers to any molecule, compound or composition, in which it is desired that its bioactivity be stabilized when that molecule, compound - or composition is subjected to at least one cycle change of state and / or is maintained under certain conditions, as described in this document. For the methods and compositions described in this document, any active agent can be maintained within a silk fibroin matrix. Examples of active agents include, but are not limited to, proteins, peptides, antigens, immunogens, vaccines, antibodies or parts of them (eg, antibody-like molecules), enzymes, nucleic acids (eg, oligonucleotides, polynucleotides, siRNA, ShRNA ), aptamers, viruses, bacteria, small molecules, photosynthetic cells and energy capture compounds, flavoring agents, antibiotics, therapeutic agents, diagnostic agents, such as contrast or dye agents,
viral vectors and antivenom.
As used herein, the terms "proteins" and "peptides" are used interchangeably to denote a series of amino acid residues linked to one another through peptide bonds between the alpha-amino and carboxy groups of adjacent residues.
The terms "protein" and "peptide", which are used interchangeably in this document refer to a polymer of protein amino acids, including modified amino acids (eg, phosphorylated, glycosylated, etc.) and amino acid analogs, regardless of their size or function.
Although "protein" is often used with reference to relatively large polypeptides, and "peptide" is often used with reference to small polypeptides, the use of these terms in the art overlaps and varies.
The term "peptide" as used herein refers to peptides, polypeptides, proteins and protein fragments, unless otherwise indicated.
The terms "protein" and "peptide" are terms used in this document interchangeably to refer to a gene product and its fragments.
Thus, exemplary peptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, parallels, fragments and other equivalents,
variants, fragments and analogues of the foregoing.
The term "nucleic acids" used in this document refers to polynucleotides, such as deoxyribonucleic acid (DNA) and, where appropriate, ribonucleic acid (RNA), or polymers thereof in single or double filamentary mode.
Unless specifically limited, the term encompasses nucleic acids containing known natural nucleotide analogs that have binding properties similar to those of the reference nucleic acid and are metabolized in a similar way to naturally occurring nucleotides.
Unless otherwise specified, a specific nucleic acid sequence, implicitly and conservatively, includes modified variants thereof (for example, degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated.
Specifically, substitutions of degenerate codons can be obtained by generating sequences in which the third position of one or more selected codons (or all) is replaced with mixed base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19 : 5081 (1991); Ohtsuka, et al., J. Biol. Chem. 260: 2605- 2608 (1985), and Rossolini et al., Mol. Cell. Probes 8: 91-98 (1994)). The term "nucleic acids" should also be understood as including, as equivalents, derivatives, variants and analogs of RNA or DNA obtained from nucleotide analogs, and single-stranded (sense or antisense) and double-stranded polynucleotides .
The term "small interfering RNA" (siRNA), also referred to herein as "small interfering RNA" is defined as an agent that works to inhibit expression of a target gene, for example, by RNAi. A SiRNA can chemically synthesized, it can be produced by in vitro transcription, or it can be produced within a host cell.The siRNA molecules can also be generated by double-stranded RNA cleavage, where a strand is identical to the message to be The term "siRNA" refers to the duplex of small inhibitory RNA that induces the interfering RNA pathway (RNAi). These molecules can vary in length (usually 18-30 base pairs) and contain varying degrees of complementarity with respect to Target mRNA in the antisense chain Some, but not all, sSiRNAs have unpaired bases overhanging the 5 'or 3' end of the 60 sense strands and / or antisense strands. The term "siRNA" includes two-strand duplex separate strands as well as simple filaments that can form staple structures that comprise a duplex region.
The term "shRNA", as used in this document, refers to the small RNA with a clamp structure, which functions as an RNAi and / or sSiRNA species, but differs, so that the shRNA species are similar in structure to a double filament clamp for increase stability. The term "RNAi" as used herein refers to interfering RNA, or interfering RNA molecules are nucleic acid molecules or their analogs, for example, RNA-based molecules that inhibit gene expression. RNAi refers to a means of silencing the selective post-transcriptional gene. RNAi can result in the destruction of specific mRNA, or prevent the processing or translation of RNA, such as mRNA.
The term "enzymes", as used in this document, refers to a protein molecule that catalyzes chemical reactions of other substances, without being destroyed or substantially altered after the completion of the reactions. The term can include naturally occurring enzymes and bioengineering enzymes or mixtures thereof. Examples of enzyme families include kinases, dehydrogenases, oxidoreductases, GTPases, carboxyl transferases, acyl transferases, decarboxylases, transaminases, racemases, methyl transferases, formyl transferases and acetodecarboxylases.
The term “vaccines” as used in this document refers to any preparation of dead microorganisms, live attenuated organisms, subunit antigens, toxoid antigens, conjugated antigens or other types of antigenic molecules that, when introduced into the body of individuals, produce immunity to a specific disease, causing the activation of the immune system, formation of antibodies and / or the creation of a T cell and / or B cell response. In general, vaccines against microorganisms are directed at at least part of a virus, bacteria , parasites, mycoplasma, or other infectious agent. In one embodiment, the vaccine encapsulated in a silk fibroin matrix is a live vaccine.
As used herein, the term "aptamers" means a single-stranded, partially single-stranded, partially double-stranded or double-stranded nucleotide sequence capable of specifically recognizing a selected non-oligonucleotide molecule or group of molecules. In some modalities,
the aptamer recognizes the non-oligonucleotide molecule or group of molecules through a mechanism other than Watson's triple formation or base pairing.
Aptamers may include, without limitation, the defined sequence segments and sequences comprising nucleotides, ribonucleotides, deoxyribonucleotides, nucleotide analogs, modified nucleotides and nucleotides comprising structure modifications, branch points and nucleotide residues, groups or bridges.
Methods of selecting aptamers for binding to a molecule are well known in the art and readily accessible to one of ordinary skill in the art.
As used herein, the term "antibody" or "antibodies" refers to an intact immunoglobulin or a monoclonal or polyclonal antigen binding fragment with the Fc region (crystallizable fragment) or FcRn binding fragment from the Fc region.
The term "antibodies" also includes "antibody-like molecules", such as antibody fragments, for example, antigen-binding fragments.
Antigen-binding fragments can be produced by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies. "Antigen-binding fragments" include, inter alia, Fab, Fab ', F (ab') 2, Fv, dab and fragments of the complementarity determining region (CDR), single chain antibodies (scFv), domain antibodies simple, chimeric antibodies, diabodies and polypeptides that contain at least a portion of an immunoglobulin that is sufficient to confer binding of the specific antigen to the polypeptide. Linear antibodies are also included for the purposes described in this document. The terms Fab, Fc, prce ', F (ab') 2 and Fv are used with conventional immunological meanings (Klein, Immunology (John Wiley, New York, NY, 1982); Clark, WR (1986) The Experimental Foundations of Modern Immunology (Wiley & Sons, Inc., New York); and Roitt, TI. (1991) Essential Immunology, 7th Ed., (Blackwell Scientific Publications, Oxford)). Antibodies or antigen-binding fragments specific to various antigens are commercially available from vendors, such as R&D Systems, BD Biosciences, e-Biosciences and Miltenyi, or can be produced against these cell surface markers using methods known to skilled in the art. in art.
As used in this document, the term "complementarity determining regions" (CDRs, that is, CDR1, CDR2 and CDR3) refers to the amino acid residues of an antibody variable domain whose presence is necessary for binding to the antigen. Each variable domain typically has three CDR regions identified as CDR1, CDR2 and CDR3. Each complementarity-determining region can comprise “amino acid residues from a" complementarity-determining region ”, as defined by Kabat (i.e., with respect to residues 24-34 (Ll), 50-56 (L2) and 89-97 (13) in the light chain variable domain and 31-35 (H1), 50-65 (H2) and 95-102 (H3) in the heavy chain variable domain; Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed .
Public Health Service, National Institutes of Health, Bethesda, Md. (1991)) and / or those residues of a "hypervariable loop" (that is, with respect to residues 26-32 (Ll1), 50-52 (12) and 91-96 (L3) in the light chain variable domain and 26-32 (H1), 53-55 (H2) and 9296-101 (H3) in the heavy chain variable domain; Chothia and LeskdJ.
Mol.
Biol. 196: 901-917 (1987)). In some cases, a complementarity-determining region may include amino acids, both of which are a CDR region, defined according to
Kabat and a hypervariable loop.
The term "linear antibodies" refers to the antibodies described in Zapata et al., Protein Eng., 8 (10): 1057-1062 (1995). Briefly, these antibodies comprise a pair of tandem Fd segments (VH-CH1-VH-CH1) which, together with the complementary light chain polypeptides, form a pair of antigen-binding regions. Linear antibodies can be bispecific or monospecific.
The term "single chain Fv" or "scFv" antibody fragments as used herein means antibody fragments comprising the VH and VL domains of the antibody, where these domains are present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains that allows O scFv to form the desired structure for binding to the antigen. (Plúckthun, The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp 269-315 (1994)). The term "diabody", as used herein, refers to small antibody fragments with two antigen-binding sites, fragments that comprise a heavy chain variable domain (VH) connected to a light chain variable domain (VL) in the same polypeptide chain (VH-VL). Using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with complementary domains on another chain and create two antigen-binding sites. (EP 404,097, WO 93/11161; Hollinger et al., Proc. Natl. Acad. Sd. USA, PO: 6444-6448 (1993)).
As used herein, the term "small molecules" refers to natural or synthetic molecules, including, but not limited to, peptides, peptidomimetics, amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, aptamers, nucleotides, nucleotide analogs, organic Or .— inorganic compounds (ie, including organometallic and heteroororganic compounds) having a molecular weight of less than about 10,000 grams per mole, organic or inorganic compounds with a molecular weight of less than about 5,000 grams per mole, organic or inorganic compounds with a molecular weight of less than about
1,000 grams per mol, organic or inorganic compounds with a molecular weight of less than about 500 grams per mol, and salts, esters, and other pharmaceutically acceptable forms of such compounds.
The term "bacteria" as used in this document covers all variants of bacteria, for example, prokaryotic organisms and cyanobacteria. The bacteria are small (typical linear dimensions of about 1 m), not compartmentalized, with circular DNA and 708 ribosomes.
The term "antibiotics" is used throughout this document to describe a compound or composition that decreases the viability of a microorganism, or that inhibits the growth or reproduction of a microorganism. As used in this description, an antibiotic is also intended to include an antimicrobial, bacteriostatic or bactericidal agent. Examples of antibiotics include, but are not limited to, penicillins, cephalosporins, penemas, carbapenemas, monobactams, aminoglycosides, sulfonamides, tetracyclines, macrolides, quinolones, lincosides, chloramphenicol, vancomycin, metronidazole, rifanpine, trimethoxamine, isoniazid, methoxyminide, isoniazid, methoxyamine, isoniazid;
The term "cells" used in this document refers to any cell, prokaryote or eukaryote, including plants, fungi, worms, insects and mammals. Mammalian cells include, without limitation those of primates, humans and an animal cell of interest, including, without limitation, rat, hamster, rabbit, dog, cat, domestic animals such as horses, cattle, mice, sheep, canines, felines, etc. The cells can be of a wide variety of tissue types, such as, without limitation; hematopoietic, neural, mesenchymal, cutaneous, mucous, stromal, muscular spleen, reticulum, epithelial, endothelial, liver, kidney, gastrointestinal, pulmonary, T cells etc. Stem cells, embryonic stem cells (ES), cells derived from ES and stem cell progenitors are also included, including, without limitation, hematopoietic, neural, stroma, muscle, cardiovascular, liver, pulmonary, gastrointestinal stem cells, etc. Yeast cells can also be used as cells in some embodiments. In some embodiments, the cells can be ex vivo, or cells cultured, for example, in vitro. For example, for cells ex vivo, cells can be obtained from an individual, where the individual is healthy and / or affected with a disease. The cells can be obtained, as a non-limiting example, by biopsy or other surgical means known to those skilled in the art.
The term "photosynthetic and energy-capturing compounds" refers to molecules that can obtain or absorb light energy, for example, chlorophyll. As used herein, the term "viral vector" typically includes foreign DNA that is to be inserted into a host cell and generally includes an expression cassette. The foreign DNA can comprise an entire transcriptional unit, poly-A promoter gene, or the vector can be engineered to contain promoter / transcription termination sequences in such a way that only the gene of interest needs to be inserted. These types of control sequences are known in the art and include promoters for initiation of transcription, optionally with an operator, along with sequences of ribosome binding sites. Viral vectors include, but are not limited to, lentivirus vectors, retroviral vectors, lentiviral vectors, herpes simplex viral vectors, adenoviral vectors, adeno-associated viral vectors (AAV), EPV, EBV, or variants or their derivatives. Several companies commercially produce such viral vectors, including, but not limited to Avigen, Inc. (Alameda, Calif .; AAV vectors), Cell Genesys (Foster City, Calif .; retroviral, adenovirus, AAV, and lentiviral vectors), Clontech ( retroviral and baculoviral vectors), Genovo, Inc. (Sharon Hill, Pa .; adenovirus and AAV vectors), Genvec (France; adenovirus vectors), IntroGene (Leiden, Netherlands; adenovirus vectors), Molecular Medicine (retroviral vectors , adenovirus, AAV, viral herpes), Norgen (adenovirus vectors), Oxford BioMedica (Oxford, United Kingdom; lentiviral), and Transgene (Strasbourg, France; adenovirus, vaccine, retrovirus and lentiviral vectors).
As used herein, the term "antigens" refers to a molecule or portion of a molecule capable of being bound by a selective binding agent, such as an antibody, and, additionally, capable of being used in an animal to induce the production of antibodies capable of binding to an epitope of that antigen.
An antigen can have one or more epitopes.
The term "antigen" can also refer to a molecule capable of being linked by an antibody or a T cell receptor (TCR) if presented by MHC molecules.
The term "antigen", as used herein, also encompasses T-cell epitopes.
An antigen is additionally capable of being recognized by the immune system and / or of being able to induce a humoral immune response and / or the cellular immune response that leads to the activation of B and / or T lymphocytes.
However, this may require that at least in certain cases, the antigen contains, or is linked to, a Th cell epitope and is supplied in the adjuvant.
An antigen can have one or more epitopes (epitopes B and T). The specific reaction mentioned above is intended to indicate that the antigen will preferably react normally in a highly selective manner, with its corresponding antibody, or TCR and not with the various other antibodies or TCRs that can be evoked by other antigens.
Antigens, as used herein, may also be mixtures of several individual antigens.
As used herein, the term "virus" refers to an infectious agent composed of nucleic acid encapsulated in a protein.
Such infectious agents are incapable of autonomous replication (that is, replication requires the use of host cell machinery). Viral genomes can be single-stranded (ss) or double-stranded (ds), RNA or DNA, and may or may not employ reverse transcriptase (RT). In addition, RNASsS viruses can be both sense (+) and antisense (-). Examples of viruses include, but are not limited to, DNA viruses (for example, Adenovirus, herpes virus, poxvirus), DNAss viruses (for example, Parvovirus), RNAds viruses (for example, Reovirus), (+) RNAssS viruses ( for example, Picornavirus, Togaviruses), (-) RNASS virus (for example, Orthomyoxivirus, Rhabdovirus), RNAsSS-RT virus, that is, RNA (+) felt with intermediate DNA in the life cycle (for example, Retrovirus), and DNAds-RT virus (for example, Hepadnavirus). In some embodiments, viruses can also include wild-type (natural) viruses, dead viruses, live attenuated viruses, "modified viruses," recombinant viruses or any combination thereof.
Other examples of viruses include, but are not limited to, enveloped viruses, respiratory syncytial viruses, non-enveloped viruses, bacteriophages, recombinant viruses, and viral vectors. the term "bacteriophages" as used herein refers to viruses that infect bacteria.
The term "antivenom", as used herein, refers to a biological product used to treat poisonous bites or bites. Antivenom is created by removing the poison from the desired snake, spider or insect. The poison is then diluted and injected into a horse, sheep, goat or cat. The animal individual will undergo an immune response to the venom, producing antibodies against the active molecule of the venom which can then be harvested from the animal's blood and used to treat the poisoning.
The term "therapeutic agents" is recognized in the art and refers to any chemical fraction that is a biological, physiological or pharmacologically active substance that acts locally or systemically on an individual. Examples of therapeutic agents, also known as "drugs" are described in well-known bibliographic references, such as the Merck Index, Physicians Desk Reference, and The Pharmacological Basis of Therapeutics and include, without limitation, drugs, vitamins; mineral supplements, substances used for the treatment, prevention, diagnosis, cure or mitigation of a disease or illness, substances that affect the structure or function of the body; or prodrugs, which become biologically active or more active after being placed in a physiological environment. Various forms of a therapeutic agent can be used which are capable of being released from the target composition into adjacent tissues or fluids upon administration to an individual.
Examples include steroids and steroid esters (eg, estrogen, progesterone, testosterone, androsterone, cholesterol, norethindrone, digoxigenin, cholic acid (cholic), deoxycholic acid and chenodeoxycholic acid), boron-containing compounds (eg carborane), chemotherapeutic nucleotides , medicines (eg, antibiotics, antivirals, antifungals), enodiins (eg, calicheamicins, speramycin, dinemicin, neocarzinostatin chromophore and Kkedarcidin chromophores), heavy metal complexes (eg cisplatin), hormone antagonists (eg “eg , tamoxifen), proteins - non-specific (non-antibody) (for example, sugar oligomers), oligonucleotides (for example, antisense oligonucleotides that bind to a target nucleic acid sequence (for example, mRNA sequence)), peptides, proteins, antibodies, photodynamic agents (for example, rhodamine 123), radionuclides (for example, I-131, Re-l86, Re-188, Y-90, Bi-212, A -211, Sr-89, Ho-166, Sm-153, Cu-67 and Cu-64), toxins (for example, ricin), and transcription-based pharmaceutical substances.
A "diagnostic agent" is any chemical fraction that can be used for diagnosis. For example, diagnostic agents include radioisotope-containing imaging agents, such as, Indian or technetium; contrast agents or dyes containing iodine, gadolinium or cyanine; enzymes such as horseradish peroxidase, GFP, alkaline phosphatase, or B-galactosidase, fluorescent substances such as europium derivatives, luminescent substances such as N-methylacrylide derivatives or the like.
Immunogen and Vaccines In certain modalities, the active agents are immunogens. In some embodiments, the immunogen is a vaccine. As demonstrated in this document, a trapped vaccine model, the MMR vaccine consists of live, attenuated virus and subsequently recovered from a silk vehicle maintained in significant biological activity compared to the non-encapsulated silk vaccine. In one embodiment, a stabilized MMR vaccine is provided herein that can be stored at room temperature for several weeks, while maintaining its original activity in a substantial proportion. The stabilization of live attenuated vaccines provides an important advance in immunization programs, reducing transportation, equipment and training costs, reducing waste and expanding immunization programs.
The term "immunogen" refers to any substance, for example, vaccines, capable of inducing an immune response in an organism. An "immunogen" is capable of eliciting an immune response against itself upon administration to an individual. The term "immunological" as used herein in connection with an immune response, refers to the development of a humoral response (mediated by antibodies) and / or a cellular response (mediated by the specific T cells of antigens or their products secretion) directed against an immunogen in a recipient individual. Such a response may be an active response induced by the administration of an immunogenic or immunogenic peptide to an individual or a passive response induced by the administration of antibody or initiated T cells that are directed to the immunogen. A cellular immune response is caused by the presentation of polypeptide epitopes in association with MHC Class I or Class IT molecules to activate CD4 + helper T cells specific for the antigen and / or CD8 + cytotoxic T cells. Such a response may also involve the activation of monocytes, macrophages, NK cells, basophils, dendritic cells, astrocytes, microglia cells, eosinophils or other components of innate immunity.
The term "immunogenicity" refers to the ability of a substance, such as an antigen or epitope, to elicit a humoral and / or cell-mediated immune response in an individual.
One skilled in the art can easily assess the —immunogenicity of a substance.
The presence of a cell-mediated immune response can be determined by any method recognized in the art, for example, proliferation assays (CD4 + T cells), CTL assays (cytotoxic T lymphocytes) (see Burke, supra; Tigges, supra) or immuno - histochemistry with an individual's tissue section to determine the presence of activated cells, such as monocytes and macrophages, after administration of an immunogen.
One skilled in the art can readily determine the presence of the humoral-mediated immune response mediated in an individual by any well-established methods.
For example, the level of antibodies produced in a biological sample such as blood can be measured by western blotting, ELISA or other known methods for detecting antibodies.
Immunogens useful in some embodiments of the various aspects described in this document include dead pathogens, live attenuated live pathogens, protein subunits and their conjugates, inactivated toxins and synthetic peptides, carbohydrates and their conjugates, and antigens.
The term "pathogen" as used herein means any disease-producing agent (especially a virus or bacterium or other microorganism). The term "dead pathogens" is used in this document with reference to pathogens that were previously virulent (ie, capable of causing disease) but have been destroyed with chemicals or heat.
Examples of vaccines comprising dead pathogens include, without limitation, the flu vaccine, the cholera vaccine, the bubonic plague vaccine, the polio vaccine, the hepatitis A vaccine and the rabies vaccine.
The term "live attenuated pathogens" as used in this document refers to pathogens that have not been inactivated, that is, pathogens capable of replicating in permissive cells and inducing a specific immune response, but do not induce diseases caused by agents corresponding wild-type pathogens in an individual.
Live, attenuated pathogens can be produced by one skilled in the art, for example, by culturing wild-type pathogens under conditions that disable their virulent properties, or by using less virulent, but closely related organisms to produce such an immune response. Examples of live, attenuated pathogens include, but are not limited to viral diseases, yellow fever, measles, rubella and mumps and typhoid bacterial disease. In some embodiments, the live Mycobacterium tuberculosis vaccine is not obtained from a contagious strain, but contains a modified virulent strain called "BCG" used to induce an immune response to the vaccine. The live attenuated vaccine containing the strain Yersinia pestis EV is used for pest immunization.
In some embodiments, an immunogen used in the compositions described herein may be an inactivated toxin that causes disease instead of the pathogen. Such non-limiting compositions include tetanus and diphtheria.
In some embodiments, while an immunogen may comprise an inactivated compound, for example, an inactivated toxin, from a pathogen, synthetic peptides, carbohydrates or antigens can also be used as an immunogen in immunogenic compositions described herein.
In certain embodiments, an immunogen used in the compositions described herein may include a protein subunit, that is, a fragment of a dead or alive, attenuated pathogen or a conjugate thereof. Such examples include, but are not limited to, the Hepatitis B virus subunit vaccine, which is composed only of the virus's surface proteins (previously extracted from the blood serum of chronically infected patients, but now produced by recombination of viral genes in yeast) , the virus-like particle vaccine (VLP) against human papillomavirus (HPV), which is composed of the main viral capsid protein, and the flu virus hemagglutinin and neuraminidase subunits.
In such modalities, certain pathogens have external polysaccharide coatings, which are weakly immunogenic.
By attaching these outer coatings to proteins (for example, toxins), the immune system is able to recognize the polysaccharide as if it were a protein antigen.
An exemplary conjugated immunogen is that used in the vaccine against Haemophilus influenzae type B.
Thus, immunogenic conjugates are also included in the aspects described in this document.
Additional examples of immunogens include those that can be derived from hepatitis B virus, Haemophilus influenzae type B, poliovirus, Neisseria meningitides C, influenza, Varicella, Mycobacteria tuberculosis or Calmette-Guérin bacillus, tetanus toxoid, diphtheria toxoid, or Bordetella pertussis .
The immunogen can also be a combination of immunogen, such as, DTaP, DTwP, DTPwP hepatitis B, DTP hepatitis B Hib or DTaP hepatitis B Hib IPV.
In some embodiments, the immunogen is a bacterium, such as Mycobacteria tuberculosis, bacille Calmette-Guérin or Bordetella pertussis. The bacterial immunogen can be killed or attenuated. The immunogen can comprise a bacterial subunit. Examples of immunogenic bacterial subunits include those derived from Neisseria meningitidis Type C, Haemophilus influenzae type B, Streptococcus pneumoniae, group B streptococci, or Bordetella pertussis. The bacterial immunogen can be recombinant. The bacterial subunit can be or include a polysaccharide. In still other modalities, the immunogen is a viral subunit, for example, derived from hepatitis B virus or human papillomavirus. The viral immunogen can also be recombinant. The viral immunogen can also comprise killed viruses.
The stabilized immunogen as described in this document can be a vaccine product, for example, BIOTHRAXº (anthrax adsorbed vaccine, Emergent Biosolutions, Rockville, MD); TICEº BCG Live (Bacillus Calmette-Guérin for intravesical use, Organon Tekina Corp. LLC, Durham, NC); MYCOBAXº BCG Live (Sanofi Pasteur Inc.); Daptacelº (vaccine adsorbed against diphtheria toxoids, tetanus and acellular pertussis [Tdap], Sanofi Pasteur Inc.); INFANRIXº (triple vaccine (Tdap) adsorbed,
GlaxoSmithKline); TRIPEDIA (triple vaccine (Tdap), Sanofi Pasteur); TRIHIBITº (Tdap / Hibl, Sanofi Pasteur); KINRIXº (vaccine against diphtheria and tetanus toxoids, adsorbed, acellular against pertussis and inactivated polio virus, GlaxoSmithKline); PEDIARIXº (Tdap-HepB-IPV, GlaxoSmithKline); PENTACELº (vaccine against diphtheria and tetanus toxoids, adsorbed, acellular against pertussis and polio virus and Haemophilus b conjugates, inactivated [tetanus toxoid conjugate] Sanofi Pasteur), diphtheria and tetanus toxoids, adsorbed (for pediatric use, Sanofi Pasteur) ; DECAVACº (diphtheria and tetanus toxoids, adsorbed, for adult use, Sanofi Pasteur); ACTHIBº (tetanus toxoid conjugate vaccine and Haemophilus b, Sanofi Pasteur); PEDVAXHIBº (Hib vaccine, Merck); Hiberix (tetanus toxoid conjugate vaccine and Haemophilus type b, booster dose, GlaxoSmithKline); Comvaxº (Hepatitis B-Hib vaccine, Merck); HAVRIXº (hepatitis A vaccine, pediatric, GlaxoSmithKline); VAQTA (Hepatitis A vaccine, pediatric, Merck); ENGERIX-Bº (Hep BB, pediatric,
teenager, GlaxoSmithKline); RECOMBIVAX HBº (vaccine against hepatitis B, Merck); TWINRIXº (HepA / HepB BE vaccine,
18 years or older, GlaxoSmithKline); CERVARIXº (bivalent human papillomavirus [types 16 and 18] recombinant vaccine, GlaxoSmithKline); GARDASILº (vaccine against bivalent human papillomavirus [types 6, 11, 16 and 18], recombinant, Merck); AFLURIA (Flu vaccine, 18 years or older, CSL); AGRIFLU "(flu virus vaccine for intramuscular injection, Novartis Vaccines); FLUARIXº (Flu vaccine, 18 years old or more, GaxoSmithKline); FLULAVALº (Flu vaccine, 18 years old or more, GaxoSmithKline); FLUVIRINº (vaccine against influenza, 4 years and above, Novartis Vaccine); FLUZONEº (Flu vaccine, 6 months or more, Sanofi Pasteur); FLUMISTº (flu vaccine, 2 years or more, Medlimmune); IPOLº (polio e-IPV vaccine, Sanofi Pasteur); OJE-VAXº (inactivated Japanese encephalitis virus vaccine, BIKEN, Japan); IXIAROº (inactivated Japanese encephalitis virus vaccine, Novarits); MENACTRAº (meningococcal vaccine [Groups A, C, Y and W- 135] and against diphtheria, Sanofi Pasteur); MENOMUNES-A / C / Y / W-135 (meningococcal polysaccharide vaccine, Sanofi Pasteur); MMRIIº (MMR vaccine, Merck); MENVEOº (meningococcal conjugate vaccine [Groups A, Cc, Y and W-135]) and oligosaccharide diphtheria CRM: 197, Novartis Vaccines); PROQUADº (MMRe varicella vaccine, Merck); PNEUMO VAX 23º (pneumococcal polysaccharide vaccine, Merck); PREVENARº (7-valent pneumococcal vaccine, Wyeth / Lederle); PREVENAR-13º (pneumococcal 13-valent vaccine, Wyeth / Lederle), POLIOVAX "(inactivated polio virus, sanofi pasteur); IMOVAXº (rabies vaccine,
Sanofi Pasteur); RABAVERT "(Rabies vaccine, Chiron); ROTATEÇQº (Rotavirus vaccine, live, oral, pentavalent, Merck); ROTARIXº (Rotavirus, live, oral vaccine, GlaxoSmithKline); DECAVAC '" "(vaccine against tetanus and diphtheria toxoids, sanofi pasteur), Td (generic) (tetanus and diphtheria toxoids, adsorbed, Massachusetts Biol. Labs); TYPHIMVIº (polysaccharide vaccine against typhoid Vi, Sanofi Pasteur); ADACELº (tetanus toxoid, reduced diphtheria toxoid and acellular pertussis, pasofi pasteur); Boostrixº (tetanus toxoid, reduced diphtheria toxoid and acellular whooping cough, GlaxoSmithKline); VIVOTIFO (typhus vaccine, live, oral, Berna Biotech); ACAM2000 "(smallpox vaccine (vaccinia), live, Acambis, Inc.); Dryvaxº (smallpox vaccine (vaccinia)); VARIVAXº (chickenpox vaccine, live, Merck); YF-VAXº (vaccine against yellow fever, Sanofi Pasteur); ZOSTAVAXº (Varicella-zoster, Merck), or combinations thereof. Any vaccine products listed in the Center for Disease Control and Prevention (CDC) database can also be included in the compositions described in this document.
In some embodiments, animal vaccines, such as canine and feline vaccines, can also be included in the methods and compositions described in this document. Examples of animal vaccines include, but are not limited to, DURAMUNE MAX 5 (vaccine against five diseases: canine distemper, infectious canine hepatitis, adenovirus type 2, parainfluenza, and parvovirus, Fort Dodge); NEO PARº (parvovirus, Neo Tech); VANGUARDº PLUS 5 (canine distemper, adenovirus types 1 and 2, Parainfluenza and Parvovirus, Pfizer); BRONCHI-SHIELDº III (Canina, Parainfluenza, Fort Dodge) and ECLIPSE 4º (feline rhinotracheitis, Calici feline virus and panleukopenia virus and Chlamydia psittaci, Schering-Plow / Intervet). Any commercially available vaccines for animals can be included in the compositions described in this document.
Live Attenuated Viruses Live attenuated immunogenic compositions, for example, live attenuated virus vaccines, can generally elicit more lasting immune responses. Thus, they are sometimes the preferred compositions for administration to an individual, for example, a healthy mammal. In some embodiments, the immunogens used in the compositions described in this document are live, attenuated pathogens. In specific modalities, immunogens are live attenuated viruses. Thus, immunogenic methods and compositions comprising at least one live attenuated virus, (including at least two live attenuated viruses, at least three live attenuated viruses, or more) are also described herein. The immunogenic compositions include a matrix of silk fibroin, and at least one live attenuated virus (including at least two live attenuated viruses, at least three live attenuated viruses or more) distributed therein, where Live attenuated virus (s) retains at least about 30% of its original infectivity when the composition is (a) subjected to at least one cycle of change of state, and / or (b), maintained for a period of time, under a specified condition. In some embodiments, the live attenuated virus (s) can retain at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, less about 90%, at least about 95% original infectivity or more.
As used herein, the term "infectivity" in reference to a virus means the characteristic of a virus that incorporates the ability to enter, survive and multiply or elicit an immune response in a susceptible host. Any methods known to the person skilled in the art for the determination of infectivity of the virus can be used for the purposes described herein, for example, the in vitro infectivity assay described in Example 1 can be employed.
In the specific modalities, the live attenuated virus can be an enveloped virus, such as Paramyxoviridae, Togaviridae, Orthomyxoviridae, Flaviviridae, Herpesviridae, Rhabdo virus or Retroviridae.
These live, attenuated, enveloped viruses can be chickenpox, measles, mumps virus, German measles virus, respiratory syncytial virus, yellow fever virus, or influenza virus.
The term "enveloped virus" means a virus that comprises a lipid membrane or lipoprotein that surrounds its protein capsids.
These viral envelopes can be derived from portions of host cell membranes (phospholipids and proteins), but include some viral glycoproteins.
Functionally, viral envelopes can be used to help viruses enter host cells.
For example, glycoproteins on the surface of the envelope serve to identify and bind to receptor sites on the surface of the host's membrane.
The viral envelope then merges with the host's membrane, allowing the capsid and viral genome to enter and infect the host.
However, since the viral envelope is relatively sensitive to desiccation, heat and detergents, these enveloped viruses can be more easily sterilized than enveloped viruses and therefore have limited survival outside host environments.
Consequently, the immunogenic methods and compositions provided in this document are of particular importance for maintaining the survival of the live, attenuated, enveloped virus outside host environments and, thus, its infectivity, once introduced into a host cell.
In other embodiments, the live, attenuated virus may be a virus without an envelope, that is, a virus without a viral envelope, as described above. The non-enveloped virus can be rotavirus, reovirus, hepatitis virus, rabies virus and / or polio virus.
In addition, this document provides a cell-free, stabilized virus preparation comprising a matrix of silk fibroin and infectious viruses distributed, mixed or incorporated into it, where the virus retains at least about 30% of its original infectivity. , when the preparation is (a) subjected to at least one change of state cycle, and / or (b) is maintained for a period of time, under a condition specified in this document.
Pharmaceutically Acceptable Additives and Vehicles Various embodiments of the compositions described in this document may further comprise an additive distributed, mixed or incorporated into the silk fibroin matrix. In some embodiments, the additive is a stabilizing agent. The addition of the "stabilizing agent" to the compositions described in this document can further increase the stability of the active agent, that is, the active agent can retain a higher bioactivity, compared to bioactivity in the absence of the stabilizing agent. In some embodiments, the stabilizing agent is selected from the group consisting of a saccharide, a sugar alcohol, an ion, a surfactant, and any combination of these. In one embodiment, saccharide, for example, sucrose, is added in the compositions described in this document.
As an example, additional stabilizing agents can be added to the silk fibroin or matrix solution. Example of stabilizers that have previously demonstrated their effectiveness in the oral polio vaccine, as well as those disclosed in this document can be used. Stabilizing agents may include cationic stabilizers (listed from highest to lowest stabilization): (CH3) KWN '> Mg T, K *> Nat, NH > Lit; anionic stabilizers (from highest to lowest stabilization): CH3COO, SO * -, PO "> Cl", SCN ', and hard water (D20) (Dorval et al. 1989). See, for example, Mirchamsy et al. Stabilizing effect of magnesium chloride and sucrose on Sabin live polio vaccine, 41 Devel. Biol.
Standardization 255 (1978); Rapp et al., Protection of measles virus by sulfate ions against thermal inactivation, 90 J.
Bact. 132 (1965). Other stabilizing agents known in the art, for example, for the stabilization of other vaccines, can also be included in the compositions described herein, for example, amino acids, such as sodium glutamate, arginine, lysine and cysteine; monosaccharides, such as glucose, galactose, fructose and mannose; disaccharides, such as sucrose, maltose and lactose, sugar alcohols, such as, sorbitol and mannitol; polysaccharides, such as, oligosaccharides, starch, cellulose, and their derivatives, human serum albumin and bovine serum albumin, gelatin, and gelatin derivatives, such as hydrolyzed gelatin and ascorbic acid as an antioxidant.
These materials are described in publications, for example, "Toketsu-Kanso To Hogo Busshitsu (Lyophilization And Protective Materials)" written by Nei, p. 1-176, published by Tokyo Daigaku Shuppan Kai (Publishing Association of the University of Tokyo), Japan in 1972; and "Shinku Gijutsu Koza (8): Sinku Kanso (Lecture on Vacuum Technology (8): Vacuum Drying)" written by Ota et al., P.176-182, published by Nikkan Kogyo Shimbun Co., Ltd.,
Japan in 1964. In some embodiments, the compositions or preparations described in this document may further comprise a pharmaceutically acceptable carrier.
Depending on the route of administration selected, the compositions or preparations can be in any form, for example, tablet, lozenge, suspension, freely flowing powder, aerosol, and a capsule.
The term "pharmaceutically acceptable", as used herein, refers to those compounds, materials, compositions and / or dosage forms that, within the scope of medical judgment, are suitable for use in contact with the tissues of humans and animals, without excessive toxicity, irritation, allergic response, or other problem or complication, measurable with a reasonable benefit / risk ratio.
As used herein, the term "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition or vehicle for administering an active agent described herein.
Pharmaceutically acceptable vehicles include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents and absorption retardants, and the like that are compatible with the activity of the active and physiologically acceptable agent for the individual.
Some examples of materials that can serve as pharmaceutically acceptable carriers include: (i) sugars, such as, lactose, glucose and sucrose, (ii) starches, such as corn starch and potato starch, (iii) cellulose, and their derivatives, such as sodium carboxymethylcellulose, methylcellulose, ethylcellulose, microcrystalline cellulose and cellulose acetate, (iv) powdered tragacanth, (v) malt, (vi) gelatin, (vii) lubricating agents, such as, stearate magnesium, sodium lauryl sulfate and talc, (viii) excipients, such as cocoa butter and suppository waxes; (ix) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil, (x) glycols, such as propylene glycol; (xi) polyols, such as, glycerin, sorbitol, mannitol and polyethylene glycol (PEG), (XII), esters, such as ethyl oleate and ethyl laurate, (xiii) agar, (xiv) buffering agents, such as , magnesium hydroxide and aluminum hydroxide, (xv), alginic acid, (xvi) pyrogen-free water, (xvii) isotonic saline; (xviii) Ringer's solution, (xix) ethyl alcohol, (xx) pH buffered solutions, (xxi), polyesters, polycarbonates and / or polyanhydrides; (xxii) bulking agents, such as polypeptides and amino acids, (xxiii) serum component, such as serum albumin, HDL and LDL; (xxiv) C2-c12 alcohols, such as ethanol; and (Xxxv) other “non-toxic compatible substances used in pharmaceutical formulations.
Wetting agents, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, perfuming agents, preservatives and antioxidants can also be present in the formulation.
For the compositions or preparations described in this "document to be administered orally, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable excipients, such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives.
Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents.
Binders can include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc.
If desired, the tablets can be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract.
Pharmaceutically acceptable carriers can vary from a preparation described herein, depending on the route of administration and formulation. The compositions and preparations described in this document can be distributed through any mode of administration known to one skilled in the art. For example, the compositions and preparations described in this document can be delivered in a systemic manner, by routes of administration, such as, but not limited to, oral and parenteral routes, including intravenous, intramuscular, intraperitoneal, intradermal and subcutaneous administration.
In some embodiments, the compositions and preparations described in this document are in a form that is suitable for injection. In other embodiments, the compositions and preparations described in this document are formulated for oral administration.
Upon parenteral administration, a composition and preparation described in this document can generally be formulated in an injectable unit dosage form (solution, suspension, emulsion). Compositions and preparations suitable for injection include sterile aqueous solutions or dispersions. The carrier can be a solvent or dispersion medium containing, for example, water, cell culture medium, buffers (for example, phosphate buffered brine solution), polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and similar)
and suitable mixtures thereof. In some embodiments, the pharmaceutical carrier can be a buffered solution (for example, PBS).
An oral composition can be prepared in any orally acceptable dosage form including, but not limited to, tablets, capsules, aqueous emulsions and suspensions, dispersions and solutions. Vehicles commonly used for tablets include lactose and corn starch. Lubricating agents, such as magnesium stearate, are also typically added to the tablets. For oral administration in a capsule form, useful diluents include lactose and dry corn starch. When aqueous suspensions or emulsions are administered orally, the active ingredient can be suspended or dissolved in an oily phase combined with emulsifying or suspending agents. If desired, certain sweetening, flavoring or coloring agents can be added. Liquid preparations for oral administration can also be prepared in the form of a dry powder to be reconstituted with a suitable solvent before use.
The compositions may also contain auxiliary substances, such as wetting or emulsifying agents, pH buffering agents, viscosity-improving or gelling additives, preservatives, dyes and the like,
depending on the route of administration and the intended preparation. Standard texts, such as "REMINGTONS PHARMACEUTICAL SCIENCE", 17th edition, 1985, incorporated into this document as a reference, can be consulted to obtain the appropriate preparations, without undue experimentation. With respect to the compositions described in this document, however, any vehicle, diluent or additive used must be biocompatible with the active agents described in this document. Those skilled in the art will recognize that the components of the compositions must be selected so as to be biocompatible with the active agent. This presents no problem for those versed in chemical and pharmaceutical principles, or problems can be easily avoided by reference to standard texts or by simple experiments (not involving undue experimentation).
In some embodiments, the compositions and preparations described in this document can be formulated into an emulsion or a gel. Such gel compositions and preparations can be implanted in place to a tissue region of a sick individual.
For in vivo administration, the compositions or preparations described in this document can be administered with a delivery device, for example, a syringe.
Therefore, an additional aspect described in this document provides dispensing devices that comprise at least one chamber with an outlet, wherein at least one chamber comprises a predetermined amount of any composition described in this document and the outlet provides an outlet for the composition encapsulated within the chamber.
In some embodiments, a delivery device described in this document may further comprise an actuator for controlling the release of the composition through the outlet.
Such a delivery device can be any device that facilitates the administration of any composition described in this document to an individual, for example, a syringe, dry powder injector, nasal spray, nebulizer or implant, such as a circuit integrated, for example, by extended release or controlled release of any composition described in this document.
In some embodiments of the compositions described in this document, the silk fibroin matrix itself can be modified to control its degradation and thus the release of active agents, for example, such that the release occurs over a period of time varying hours to days or months.
In some embodiments, the compositions described in this document can be combined with other types of delivery systems available and known to those skilled in the art.
They include, for example, systems based on polymers, such as polylactic acid and / or polyglycolic acids, polyanhydrides, polycaprolactones, copolyoxalates, polyesteramides, polyesters, polyhydroxybutyric acid and / or combinations thereof. The microcapsules of the "preceding polymers containing medicaments are described, for example, in US Patent 5,075,109. Other examples include non-polymeric systems that are based on lipids, including sterols, such as, cholesterol, cholesterol esters and fatty acids or neuka 1 fats, such as, mono, di and triglycerides, hydrogel delivery systems; liposome-based systems; phospholipid-based systems; silastic systems; peptide-based systems or partially fused implants. Specific examples include, but are not limited to, erosion systems, in which the composition is contained in a form within a matrix (for example, as described in US Patent Nos. 4,452,775, 4,675,189, 5,736,152, 4,667 .014,
4,748,034 and - 29 5,239,660), or diffusion systems in which an active component controls the release speed (for example, as described in US Patent Numbers 3,832,253,
3,854,480, 5,133,974 and 5,407,686). The formulation can be, for example, microspheres, hydrogels, polymeric reservoirs, cholesterol matrices or polymeric systems.
In some embodiments, the system may allow the prolonged or controlled release of the composition to occur, for example, by controlling the rate of the formulation containing the diffusion or erosion / degradation composition.
In addition, a pump-based hardware delivery system can be used to deliver one or more embodiments of the compositions or preparations described in this document.
The use of long-term prolonged-release formulations or implants may be specifically suitable for the treatment of chronic diseases, such as diabetes.
Long-term release, as used in this document, means that a formulation or implant is performed and arranged to deliver the compositions or preparations described in this document, at a therapeutic level for at least 30 days, or at least 60 days.
In some embodiments, long-term release refers to a formulation or implant to be configured to deliver an active agent at a therapeutic level over several months.
Methods for Preparing a Storage-Stable Composition Methods for preparing storage-stable compositions are provided as described in this document. In some embodiments, the storage-stable compositions are immunogenic. The method includes providing a matrix or obtaining silk fibroin comprising at least one active agent, in which the at least one active agent retains at least about 30% of its original bioactivity when transported or during storage a period of time, under a specified condition. In some embodiments, the method further comprises mixing or adding at least one active agent to a silk fibroin matrix. In some embodiments, the method further comprises drying the silk fibroin matrix which comprises at least one active agent, to form a solid silk fibroin, in which the at least one active agent retains at least about 30% of the its initial bioactivity after storage or transported for a period of time, under a specified condition. In these embodiments, the silk fibroin matrix can be a solution or a gel-like solution. The silk fibroin matrix, containing at least one active agent, can be dried in air or nitrogen, or by lyophilization.
In one embodiment, the silk fibroin matrix (for example, silk solution) containing at least one active agent can be subjected to lyophilization to form lyophilized, solid-state silk fibroin loaded with the active agent, in that the at least one active agent retains at least about 60%, at least about 70% or at least about 80% of its initial bioactivity (for example, viral potency, see, for example, Example 3), for storage or transport for a period of time (for example, for at least 6 months, or up to a maximum of 6 months), under a specified condition (for example, storage or transport at 37ºC, 45ºC or above 45ºC).
In some embodiments, the method may further comprise lyophilizing silk fibroin in a solid or dry state comprising at least one active agent, for example, to further decrease the residual moisture of the composition, wherein the at least one active agent retains at least about 60%, at least about 70%, or at least about 80% of its initial bioactivity (for example, viral potency, see, for example, Example 3), during storage or transport for a period of time (for example, for at least 6 months, or up to a maximum of 6 months), under a specified condition (for example, storage or transportation, at 37ºC, 45ºC, or above 45ºC).
In one embodiment, the method of producing a solid state-stable composition includes
(a) providing or obtaining a silk fibroin matrix comprising at least one active agent, and (b) drying the silk fibroin matrix comprising at least one active agent, to form a solid silk fibroin, wherein the at least one active agent retains at least about 30% of its original bioactivity during transport or storage for a period of time, under a specified condition.
In some embodiments, the method further comprises step (c) of lyophilization of silk fibroin in the solid state of step (b), for example, to retain at least about 60%, at least about 70%, or at least about 80% of the active agent's initial bioactivity at temperatures above 0ºC, for example, more than 30ºC, more than 37ºC, more than 40ºC.
In some embodiments, silk fibroin in the solid state, from step (b) is subjected to further treatment, for example, treatment with methanol, ethanol, shear stress, electric field, pressure, etc., before the lyophilization of the step (ç). In some embodiments, the active agent is an immunogenic composition.
In one embodiment, the immunogenic composition comprises a monovalent vaccine.
In another embodiment, the immunogenic composition comprises a multivalent, or polyvalent vaccine, for example, a bivalent or trivalent vaccine.
As used herein, the term "a monovalent vaccine" refers to a vaccine that is designed for immunization against a single antigen or a single microorganism.
As used herein, the term "a multivalent or multivalent vaccine" refers to a vaccine that is designed to immunize against two or more different strains of one microorganism, or against two or more different microorganisms. For example, a bivalent vaccine is generally a vaccine that is designed to immunize against two different strains of a microorganism or against two different "microorganisms. A trivalent vaccine is generally a vaccine that is designed to immunize against three different strains of a microorganism or against three different microorganisms An exemplary trivalent vaccine is a vaccine that is intended to immunize against measles, mumps and rubella.
Without wishing to be bound by theory, silk can prevent virus proteins from undergoing heat-induced aggregation and / or increasing the glass transition temperature of the vaccine (or melting point of a viral protein), thus maintaining infectivity at elevated temperatures . Therefore, in some embodiments, the method of preparing an immunogenic composition described in this document can be employed to decrease the likelihood or the prevention of viral protein aggregation at a temperature at which a virus would otherwise aggregate in the absence of a matrix. of silk.
For example, in some embodiments, the method of preparing an immunogenic composition described in this document can be used to decrease the risk of aggregating viral proteins by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95 % or more, compared to an immunogen, without the silk fibroin matrix.
In some embodiments, the aggregation of viral proteins in an immunogenic composition described herein can be reduced by at least about 1.5 times, at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times or more, compared to an immunogen, without the silk fibroin matrix.
The aggregation of viral proteins can be determined, for example, by measuring the effective diameter of the viral particles through dynamic light scattering, as shown in Example 3. In other words, in some embodiments, the methods of preparing a composition immunogenic agents described in this document can be used to increase the temperature of viral protein aggregation, by at least about 10ºC, at least about 20ºC, at least about 30ºC, at least about 40ºC, at least about 50ºC, by at least about 60 ° C, at least, about 70 ° C, at least about 80 ° C, at least about 90 ° C, at least about 100 ° C, or more, in relation to an immunogen, without the silk fibroin matrix. The aggregation temperature of viral proteins can be determined, for example, by measuring the effective diameter of the viral particles over a temperature range using dynamic light scattering, as shown in Example 3. The temperature at which the effective particle diameter Viral starts to increase may be the temperature of viral protein aggregation.
In some embodiments, the methods of preparing an immunogenic composition described in this document can be used to increase the glass transition temperature and / or melting point of a vaccine by at least about 10 ° C, at least about 20 ° C , at least about 30 ° C, at least about 40 ° C, at least about 50 ° C, at least about 60 ° C, at least about 70 ° C, at least about 80 ° C, at least about 90 ° C, at least about 100 ° C, at least, around 125ºC,
at least about 150ºC or more, in relation to an immunogen, without the silk fibroin matrix. The glass transition temperature and / or melting point of a vaccine can be determined, for example, by means of differential scanning calorimetry as shown in Example 3.
The aqueous solution of silk fibroin used to make solid silk fibroin can be prepared using techniques known in the art. The concentration of silk fibroin in the solutions used to incorporate or transport the active agent may be suitable for the specific active agent. Any concentration of the silk fibroin solution can be used. In one embodiment, for example, for stabilizing vaccines, the concentrations of silk can be at least about 2%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 12%, at least about 14%, at least about 15%, at least at least about 16%, at least about 18%, or at least about 20% (weight / volume), inclusive. Suitable processes for preparing the silk fibroin solution are described, for example, in US Patent Application number 11 / 247,358; WO / 2005/012606 Ee WO / 2008/127401. The aqueous silk solution can then be transformed into a silk matrix,
such as silk films, insulating coatings or layers, or three-dimensional platforms, or electrically spun fibers for further processing in silk reflectors.
A microfiltration step can be employed in this document.
For example, the prepared silk fibroin solution can be further processed by syringe-based centrifugation and microfiltration before further processing on the silk matrix.
Additional polymers, for example, biocompatible and biodegradable polymers, can also be mixed with silk fibroin.
For example, additional biopolymers, such as, for example, chitosan, have desirable mechanical properties, which can be processed in water, mixed with silk fibroin, and form films in general.
Other biopolymers, such as chitosan, collagen, gelatin, agarose, chitin, polyhydroxyalkanoates, pullulan, starch (amylose amylopectin), cellulose, alginate, fibronectin, keratin, hyaluronic acid, pectin, polyaspartic acid, polylysine, pectin, eectin related or a combination thereof; can be used in specific applications and biodegradable synthetic polymers, such as polyethylene oxide, polyethylene glycol, polylactic acid, polyglycolic acid, polycaprolactone, polyiortoester, polycaprolactone,
polyfumarates, polyanhydrides and related copolymers can also be used selectively. A silk fibroin matrix can be in the solution state or in the solid state. The solid-state silk fibroin matrix can be in any material shape, such as silk fibers, electrically spun fibers, films, mats, three-dimensional platforms, dry gels, spheres (including microspheres and / or nanospheres), particles or composed of one or more shapes other than silk materials, as described in this document. In other embodiments, solid silk fibroin is a particle.
In one embodiment, silk fibroin in a solid state is a silk film. For example, a silk fibroin film can be prepared by depositing an aqueous silk fibroin solution containing (for example, the silk concentration of about 3% (weight / volume) to about 30% (weight / volume) ) or about 5% (weight / volume) to about 15% (weight / volume)) on a support substrate and allowing the silk fibroin solution to dry on a film. In this regard, the substrate coated with a silk fibroin-based solution can be exposed to air for a period of time, such as 12 hours. The deposition of the silk fibroin solution can be carried out, for example, using a spin coating method, in which the silk fibroin solution is coated by rotation on the substrate to allow the manufacture of thin membranes of non-uniform height; or simply pouring a solution of silk fibroin over the top of the substrate. The properties of the silk fibroin film, such as the thickness and content of other components, can be changed through the concentration and / or the volume of the silk fibroin solution applied to the substrate and the techniques used for processing the silk solution silk fibroin in the silk film. For example, the thickness of the silk film can be controlled by changing the concentration of silk fibroin in the solution, or by using desired volumes of a silk fibroin solution, resulting in the silk fibroin film with a thickness ranging from about from 2 to 1 mm. In one embodiment, silk fibroin can be rotationally coated onto a substrate to create films with thicknesses from about 2 nm to about 100 using various concentrations of silk fibroin and spinning speeds.
In some embodiments, instead of drying the silk fibroin solution, containing one or more active agents (eg immunogens) in gas, such air or nitrogen, the active agent containing a silk fibroin solution can be subjected to lyophilization to form a lyophilized silk fibroin matrix, for example, lyophilized silk fibroin film.
The subjection of the silk fibroin solution, containing one or more active agents (for example, immunogens such as vaccines) to freeze drying for drying, not only improves the initial recovery of the active agent (for example, immunogens such as vaccines) during manufacturing process, but also surprisingly provides greater stabilization of the active agent (for example, immunogens, such as vaccines) at elevated temperatures (for example, at room temperature or above, or 37ºC or more, or at 45ºC or above) during a extended period of time, for example, for at least about a week, at least for about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months or more.
In some embodiments, solid silk fibroin may be a composition of one or more layers of silk fibroin.
Each layer of silk fibroin can have the same or different composition or properties.
For example, each layer of silk fibroin may have the same or different concentration of silk fibroin and / or each layer may have the same or different mechanical properties and / or degradation. In one embodiment, silk fibroin in the solid state can be a multilayer silk fibroin, for example, which can be adjusted to reflect specific wavelengths.
In some embodiments, silk fibroin in the solid state may be a silk hydrogel. Methods for producing a silk hydrogel are known in the art. For example, a silk hydrogel can be produced by applying a shear stress to a solution of silk fibroin (which comprises one or more active agents, such as immunogens and silk fibroin, at a concentration of about 0.5 % (weight / volume) to about 20% (weight / volume), or about 1% (weight / volume) to about 15% (weight / volume), or about 2% (weight / volume) to about 10% (weight / volume)). In such embodiments, the weight ratio of the active agent (s) (e.g., immunogen (s)) to a silk solution can vary from about 1:10 to about 10: 1. In one embodiment, the weight ratio of the active agent (s) (for example, immunogen (s)) to a silk solution can be approximately 1: 1. See, for example, International Application Number: WO 2011/005381, the content of which is incorporated into this document as a reference, for methods of producing vortex-induced silk fibroin gelling for encapsulation and distribution. Without limitation, the other methods for producing a silk hydrogel with one or more active agents, such as immunogens distributed herein, can also be used, such as by sonication (for example, US Patent Application number 2010/0178304 and Application International number: WO 2008/150861), or by pH adjustment (for example, US Application number 2011/0171239). The content of these patent applications is incorporated into this document for reference.
In some embodiments, solid silk fibroin may include a silk microsphere.
Various methods of producing silk microspheres or nanospheres are known in the art.
In some embodiments, silk microparticles or nanoparticles can be produced by a polyvinyl alcohol (PVA) The method of phase separation, as described, for example, in International Application number WO 2011/041395, the content of which is incorporated into this document as reference.
In such embodiments, the silk concentration employed in the PVA phase separation method can vary from about 0.5% (weight / volume) to about 20% (weight / volume), or about 1% (weight / volume) volume) to about 15% (weight / volume), or about 3% (weight / volume) to about 10% (weight / volume). In one embodiment, the concentration of silk used in the PVA phase separation method can be about 5%
(weight / volume). In some embodiments, the weight ratio of active agent (s) (for example, immunogen (s)) to a silk solution can be from about 1: 300 to about 1: 2000, or about 1: 500 to about 1: 1,500. In one embodiment, the weight ratio of active agent (s) (for example, immunogen (s)) to a silk solution can be about 1: 1,000. Other methods for producing silk microspheres or nanospheres, for example, described in US Application number 2010/0028451 and International Application number WO 2008/118133 (using lipid as a template to make silk microspheres or nanospheres), and Wenk et al. .
Control Release 2008; 132: 26-34 (using the spray method to produce silk microspheres or nanospheres) can be used for the purpose of obtaining silk microparticles or nanoparticles by encapsulating an active agent, such as an immunogen described herein.
In some embodiments, silk microspheres or nanospheres can be further incorporated into a biopolymer, for example, to prolong the release of an active agent, such as an immunogen, over a period of time.
In some embodiments, the biopolymer may be a silk hydrogel that encapsulates silk microspheres or nanospheres loaded with an active agent (for example, immunogen). See, for example,
International Order number 2010/141133 for methods of producing silk fibroin platforms for the distribution of antibiotics.
In some embodiments, solid-state silk fibroin compositions (storage-stable compositions described herein) may be subjected to post-treatment, for example, to modify the rate of degradation of silk fibroin.
Additional treatment may include, but is not limited to, organic solvent treatment, mechanical treatment or electromagnetic treatment.
As an example, the rate of degradation of silk fibroin can be controlled, for example, by modifying the amount of beta-leaf crystal, and / or crystal orientation.
Accordingly, the amount of beta-sheet crystal, and / or crystal orientation in a silk fibroin can be controlled by contacting the silk fibroin with alcohol, for example, methanol or ethanol, as established in the art.
In some embodiments, silk fibroin may be subjected to a mechanical force, for example, stretching or shear stress to vary the amount of beta-sheet crystal, and / or aligning the crystal orientation.
In some embodiments, silk fibroin may be subjected to an electric field or pressure.
In some embodiments, silk fibroin can be contacted with salt.
Without wishing to be limited by theory, the rate of release of an active agent from a silk fibroin matrix can be controlled by the content of crystalline beta-sheet structures, the silk concentration and / or porosity of the fibroin matrix of silk.
Methods for forming pores in a silk matrix are known in the art, for example, the pyrogen bleach method, the lyophilization method and / or a gas formation method.
Such methods are described, for example, in US Patent Applications numbers 2010/0279112, 2010/0279112, and 7,842,780, the contents of which are incorporated herein by reference.
In some embodiments, the methods of preparing the storage-stable compositions described herein may further comprise the reduction of silk fibroin in a solid, dry state by mechanical devices for obtaining micronized particles, as defined herein.
Examples of mechanical devices for obtaining micronized particles include micronization, spraying, crushing, crushing, lyophilization or any combination thereof.
In accordance with conventional practice, the compositions described in this document are desirably processed under aseptic conditions,
using components that have become preliminarily and bacteriologically sterile.
Storage sterility can be maintained by incorporating an antigen-compatible germicidal substance, such as thimerosal.
Kits and Devices Packages and kits that comprise at least one storage-stable composition or preparation are also described in this document.
The packages can be prepared in several types of containers, which can be selected from the group consisting of a bottle, an ampoule, a capsule, a tube, a dispensing device, a bottle and a package.
In some embodiments, the delivery device is a syringe.
In some embodiments, the syringe may be needle-free.
The storage-stable composition contained in a package can be in the form of a hydrogel, gel-type particles, powder, microspheres, nanospheres, or any combination thereof.
In some embodiments, the storage-stable composition contained in a package can be lyophilized.
In some embodiments, the storage-stable composition can be loaded into an injection syringe.
The kits provided in this document comprise a package described in this document, and a pharmaceutically acceptable solution, for example, PBS.
In some embodiments, the kits may additionally comprise at least one delivery device for administration to an individual of a composition or preparation described herein.
In other modalities, the kits may also include a disinfectant.
In certain embodiments, such packages and kits described in this document can be used for vaccination purposes.
As used herein, an "individual" means a human or animal.
Usually, the animal is a vertebrate, such as a primate, rodent, domestic animal or wild animal.
Primates include chimpanzees, cynomological monkeys, spider monkeys and monkeys, for example, Rhesus.
Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters.
Domestic and wild animals include cows, horses, pigs, deer, bison, buffalo, feline species, for example, domestic cat, canine species, for example, dog, fox, wolf, bird species, for example, chicken, emu , ostrich and fish, for example, trout, catfish and salmon.
In certain embodiments of the aspects described in this document, the individual is a mammal, for example, a primate, for example, a human being.
The individual can be male or female.
Preferably, the individual is a mammal. The mammal may be a human, non-human primate, mouse, rat, dog, cat, horse or cow, but they are not limited to these examples. In addition, the methods and compositions described in this document can be used to treat domestic animals and / or pets.
Pre-loaded dispensing devices with at least one composition or preparation described in this document are also within the scope of the various aspects described in this document. The embodiments of a dispensing device comprise at least one chamber with an outlet, wherein the at least one chamber comprises a predetermined amount of the composition described herein and the outlet provides an outlet for the composition.
The term "camera", as used herein, refers to any structure configured to store and / or transmit a composition described in this document. The camera can be of any shape or any size, depending on the applications, users' needs and / or preferences. An exemplary chamber includes, but is not limited to, a drum, a tube, a cassette and a depression, for example, a microplate.
In some embodiments, the delivery device described in this document may further comprise a driver for controlling the release of the composition through the outlet, thereby administering the composition to an individual.
As used herein, the term "a driver" is a mechanical device that can convert any type of energy to move the composition through the output of the device.
As an example, a trigger can convert electrical energy to move or control the release of the composition through the outlet.
In some embodiments, it is possible to convert a pressure actuator to eliminate or control the release composition through the outlet.
For example, a syringe plunger converts the force or pressure to release a composition from the barrel (chamber), thereby injecting the composition into an individual.
Examples of delivery devices described in this document include, but are not limited to, a syringe, a dry powder injector, a nasal spray, a nebulizer, and an implant.
In some embodiments, an implant may be an integrated circuit, for example, those described in US Patent numbers 5797898, 6669683, 7052488 and 7582080. In some embodiments, the delivery devices can be used for vaccination.
In such embodiments, vaccine delivery devices / systems may include, but are not limited to, those described in US Patent Applications numbers 2004/0133160, 2004/0096455, 2005/0112135, 2005/0123565, 2009/0043280 and 2009/0143724 , as well as US numbers 5,346,481 and 5,900,238. The term "predetermined amount" is generally used in reference to an amount of a desired composition and / or determined by a user, for example, depending on the application or treatment.
In some embodiments, the term "predetermined amount" refers to an amount of a composition effective to treat or prevent a disease or disorder, for example, by increasing immunity against the disease, at least reducing, inhibiting or delaying a symptom of the disease, or the improvement of the disease, for example, with beneficial or desired clinical results.
For the purposes of various aspects described in this document, beneficial or desired clinical results include, but are not limited to, relieving one or more symptoms, decreasing the extent of the disease, stabilized disease state (for example, “does not get worse), delay or delay in disease progression, improvement or alleviation of disease status, and remission (either partial or total), whether detectable or undetectable.
In some modalities, treatment may refer to prolonged survival, compared to the expected survival if not receiving treatment.
Thus, one skilled in the art understands that a treatment can improve the condition of the disease, but it may not be a complete cure of the disease. With respect to immunogenic or vaccine compositions, the term "predetermined amount" can mean an amount of the composition effective to provide or enhance immunity to a specific disease. A blood test or any methods known to a person skilled in the art can be used to check immunity. Therefore, in some embodiments, the delivery device comprises an effective dose of the immunogenic composition or vaccine. Modalities of the various aspects described in this document can be illustrated by the following numbered paragraphs.
1. A method comprising a step of: maintaining a composition, in which the composition comprises a matrix of silk fibroin and at least one active agent distributed therein, and in which the active agent retains at least about 30% of the its original bioactivity when the composition is (a) subjected to at least one freeze-thaw cycle, or (b) maintained for at least about 24 hours at a temperature above 0ºC, or (c) both (a ) and (b).
2. The method according to paragraph 1, in which the active agent retains at least about 50% of its initial bioactivity.
3. The method according to paragraph 1 or 2, in which The active agent retains at least about 80% of its initial bioactivity.
4. The method according to any of paragraphs 1 to 3, in which the composition is maintained for at least about 1 month.
5. The method according to any of paragraphs 1 to 4, in which the composition is maintained for at least about 6 months.
6. The method according to any of paragraphs 1 to 5, wherein the composition is a film, a fiber, a particle, a gel or a hydrogel.
7. The method according to any of paragraphs 1 to 6, in which the composition is lyophilized.
8. The method according to any of paragraphs 1 to 7, in which the composition is micronized.
9. The method according to paragraph 8, in which the micronized composition consists of nanoparticles or microparticles.
10. The method according to paragraph 9, wherein the nanoparticles or microparticles have a size of about 10 nm to about 1,000 µm.
11. The method according to any of the paragraphs
1 to 10, wherein the composition further comprises an additive.
12. The method according to paragraph 11, wherein the additive is selected from a stabilizing agent, a pharmaceutically acceptable carrier, or any combination thereof.
13. The method according to any of paragraphs 1 to 12, wherein the composition is maintained at a temperature of about 0 ° C to above room temperature.
The method according to claim 13, wherein the composition is maintained at a temperature around the ambient temperature to about 37 ° C.
15. The method according to any one of paragraphs 1 to 14, in which the composition is kept at a temperature above 37ºC.
16. The method according to any of paragraphs 1 to 15, in which the composition is exposed to light.
17. The method according to any of paragraphs 1 to 16, wherein the composition is maintained at a relative humidity of at least about 10%.
18. The method according to any of paragraphs 1 to 17, in which the active agent is selected from the group consisting of proteins, peptides, antigens, immunogens, vaccines, antibodies or parts of them, molecules similar to antibodies, enzymes , nucleic acids,
SiRNA, ShRNA, aptamers, viruses, bacteria, small molecules, cells, photosynthetic compounds and energy capture, flavorings, antibiotics, therapeutic agents, diagnostic agents, viral vectors and antivenom.
19. The method according to any of paragraphs 1 to 18, wherein The active agent is an immunogen.
20. The method according to paragraph 19, in which the immunogen is selected from the group consisting of dead pathogens, live attenuated pathogens, protein subunits and their conjugate, inactivated toxins and synthetic peptides, carbohydrates and antigens.
21. The method according to paragraph 19 or 20, in which the immunogen is derived from hepatitis B virus, Haemophilus influenzae type B, poliovirus, Neisseria meningitidis C, Influenza, Varicella, Mycobacteria tuberculosis or Calmette-Guérin bacillus, toxoid tetanus, diphtheria toxoid and Bordetella pertussis.
22. The method according to paragraph 19 or 20, wherein the immunogen is a combination of immunogens selected from the group consisting of DTdaP, DTwP, DTwP hepB, DTP hep B Hib, DTdap Hep B Hib IPV, and any combinations thereof .
23. The method according to paragraph 19 or 20, wherein the immunogen is live, attenuated virus.
24. The method according to paragraph 23, in which the live, attenuated virus is an enveloped virus.
25. The method according to paragraph 24, in which the enveloped virus is selected from the group consisting of Paramyxoviridae, Togaviridae, Orthomyxoviridae, Flaviviridae, Herpesviridae, Rhabdovirus, Retroviridae, and any combinations thereof.
26. The method according to any of paragraphs 23 to 25, wherein the virus is chickenpox.
27. The method according to any of paragraphs 23 to 25, wherein The virus is Influenza.
28. The method according to paragraph 23, in which the live attenuated virus causes measles, mumps or rubella.
29. The method according to paragraph 19 or 20, wherein the immunogen is a live, attenuated, non-enveloped virus.
30. The method according to paragraph 29, in which the non-enveloped virus is rotavirus, reovirus, hepatitis virus, rabies virus or poliovirus.
31. The method according to paragraph 19, wherein the immunogen is a bacterium.
32. The method according to paragraph 31, in which the bacterium is Mycobcteria tuberculosis, bacillus Calmette-Guérin or Bordetella pertussis.
33. The method according to paragraph 19, wherein the immunogen is a bacterial subunit.
34. The method according to paragraph 33, in which the bacterial Subunit is derived from Neisseria meningitidis type C, Haemophilus influenzae type B, Streptococcus bpneumoniae, or group B streptococcus.
35. The method according to paragraph 33, where the Subunit is a bacterial polysaccharide.
36. The method according to paragraph 19, wherein O immunogen is a viral subunit.
37. The method according to paragraph 36, in which the viral subunit is derived from the hepatitis B virus or human papillomavirus.
38. The method according to paragraph 19, where the immunogen is recombinant.
39. The method according to paragraph 19, in which the immunogen is a vaccine product selected from the group consisting of anthrax vaccine (BioThrax); BCG (Bacillus Calmette-Guérin) (Tice, Mycobax); DTaP (Daptacel); DTaP (Infanrix); DTaP (Tripedia); DTaP / Hib (TriHIBit); DTaP-IPV (Kinrix); DTaP-HepB-IPV (Pediarix); DTaP-IPV / Hib (Pentacel), DT (diphtheria vaccine plus tetanus vaccine) (Sanofi), Hib vaccine (ACTHib); DT (Massachusetts), Hib vaccine (PedvaxHIB); Hib / Hep B (Comvax); Hep A (Havrix), Hepatitis A vaccine, Hepatitis A (Vagta), Hepatitis A vaccine, Hepatitis B (Engerix-B), Hepatitis B vaccine, Hep B
(Recombivax), vaccine against hepatitis B; vaccine against HepA / HepB (Twinrix); Human Papillomavirus (HPV) (Gardasil); influenza vaccine (Afluria); influenza vaccine (Fluarix); Influenza vaccine (FluLaval); influenza vaccine (Fluvirin); Influenza vaccine (Fluzone); influenza vaccine (FluMist); IPV (Ipol), polio vaccine, Japanese encephalitis vaccine (JE-Vax); Japanese encephalitis vaccine (Ixiaro); meningococcal vaccine (Menactra); triple viral vaccine (MMR-II); MMRV vaccine (ProQuad); pneumococcal vaccine (Pneumovax); pneumococcal vaccine (Prevenar); inactivated poliovirus (Poliovax), polio vaccine; anti-rabies vaccine (Imovax); rabies vaccine (RabAvert); rotavirus vaccine (RotaTegq); the rotavirus vaccine (Rotarix), Td vaccine (Decavac); Td vaccine (Massachusetts); DTaP vaccine (Adacel); DTaP vaccine (Boostrix); typhoid (inactivated-Typhim Vi), vaccine against typhus; Typhoid (oral - Ty21a), vaccine against typhus; Vaccinia (ACAM2000), vaccine against chickenpox (Varivax); yellow fever vaccine (YF-Vax); Zoster vaccine (Zostavax), and any combinations.
40. The method according to any of paragraphs 1 to 39, wherein the ratio of the silk fibroin matrix to the active agent is about 1: 1,000 to about 1,000: 1. 41, A storage-stable composition comprising a matrix of silk fibroin and an active agent distributed therein, where The active agent retains at least about 30% of its original bioactivity when the composition is (a) subjected to at least one freeze-thaw cycle, or (b) maintained for at least about 24 hours at a temperature above 0 ° C, or (c) both (a) and (b).
42. The composition according to paragraph 41, in which the active agent retains at least about 50% of its initial bioactivity.
43. The composition according to paragraph 41 or 42, in which the active agent retains at least about 80% of its initial bioactivity.
44. The composition according to any of paragraphs 41 to 43, wherein the composition is maintained for at least about 1 month.
45. The composition according to any of paragraphs 41 to 44, wherein the composition is maintained for at least about 6 months.
46. The composition according to any of paragraphs 41 to 45, wherein the composition is a film, a fiber, a particle, a gel or a hydrogel.
47. The composition according to any of paragraphs 41 to 46, wherein the composition is lyophilized.
48. The composition according to any of paragraphs 41 to 47, wherein the composition is micronized.
49. The composition according to paragraph 48, wherein the micronized composition is replaced by nanoparticles or microparticles.
50. The composition according to paragraph 49, wherein the nanoparticles or microparticles have a size of about 10 nm to about 1,000 µm.
51. The composition according to any of paragraphs 41 to 50, further comprising an additive distributed through the silk fibroin matrix.
52. The composition according to paragraph 51, wherein the additive is selected from a stabilizing agent, a pharmaceutically acceptable carrier, or any combination thereof.
53. The composition according to any of paragraphs 41 to 52, wherein the composition is maintained at a temperature of about 0 ° C to above room temperature.
54. The composition according to any of paragraphs 41 to 53, wherein the composition is maintained at a temperature around the ambient temperature up to about 37 ° C.
55. The composition according to any of paragraphs 41 to 54, wherein the composition is maintained at a temperature above 37ºC.
56. The composition according to any of paragraphs 41 to 55, wherein the composition is kept in the light.
57. The composition according to any of paragraphs 41 to 56, wherein the composition is maintained at a relative humidity of at least about 10%.
58. The composition of any one of claims 41 to 57, wherein the active agent is selected from the group consisting of proteins, peptides, antigens, immunogens, vaccines, antibodies or parts of them, molecules similar to antibodies, enzymes, nucleic acids, SiRNA, ShRNA, aptamers, viruses, bacteria, small molecules, cells, photosynthetic and energy collection compounds, flavorings, antibiotics, therapeutic agents, diagnostic agents, viral vectors, anti-poisons and any combinations thereof.
59. The composition according to any of paragraphs 41 to 58, wherein the active agent is an immunogen.
60. The composition according to paragraph 59, in which the immunogen is selected from the group consisting of dead pathogens, live, attenuated pathogens, protein subunits and conjugates thereof, inactivated toxins and synthetic peptides, carbohydrates and antigens.
61. The composition according to paragraph 59 or 60, in which the immunogen is derived from the hepatitis BE virus, Haemophilus influenzae type B, poliovirus, MNeisseria meningitidis Cc, Influenza, Varicella, Mycobacteria tuberculosis or Calmette-Guérin bacillus, toxoid tetanus, diphtheria toxoid and Bordetella pertussis.
62. The composition according to paragraph 59 or 60, wherein the immunogen is a combination of immunogens selected from the group consisting of DTdaP, DTwP, DTwP hepB, DTP hep B Hib, DTdaP Hep B Hib IPV and any combinations thereof.
63. The composition according to paragraph 59 or 60, wherein the immunogen is live, attenuated virus.
64. The composition according to paragraph 63, in which the live, attenuated virus is an enveloped virus.
65. The composition according to paragraph 64, in which the enveloped virus is selected from the group consisting of Paramyxoviridae, Togaviridae, Orthomyxoviridae, Flaviviridae, Herpesviridae, Rhabdovirus, Retroviridae, and any combinations thereof.
66. The composition according to any of paragraphs 63 to 65, wherein the virus is chickenpox.
67. The composition according to any of paragraphs 23 to 25, wherein the virus is Influenza.
68. The composition according to paragraph 63, in which the live attenuated virus causes measles, mumps or rubella.
69. The composition according to paragraph 59 or 60, wherein the immunogen is a live, attenuated, non-enveloped virus.
70. The composition according to paragraph 69, in which the non-enveloped virus is rotavirus, reovirus, hepatitis virus, rabies virus or poliovirus.
71. The composition according to paragraph 59, wherein the immunogen is a bacterium.
72. The composition according to paragraph 71, where the bacterium is Mycobcteria tuberculosis, bacillus Calmette-Guérin or Bordetella pertussis.
73. The composition according to paragraph 59, wherein the immunogen is a bacterial subunit.
74. The composition according to paragraph 33, where the bacterial subunit is derived from Neisseria meningitidis type C, Haemophilus influenzae type B, Streptococcus pneumoniae, or group B streptococcus.
75. The composition according to paragraph 73, wherein the subunit is a bacterial polysaccharide.
76. The composition according to paragraph 59, wherein the immunogen is a viral subunit.
77. The composition according to paragraph 76, wherein the viral subunit is derived from the hepatitis B virus or human papillomavirus.
78. The composition according to paragraph 59, where the immunogen is recombinant.
79. The composition according to paragraph 59, wherein the immunogen is a vaccine product selected from the group consisting of anthrax vaccine (BioThrax); BCG (Bacillus Calmette-Guérin) (Tice, Mycobax); DTaP (Daptacel); DTaP (Infanrix); DTaP (Tripedia); DTaP / Hib (TriHIBit); DTaP-IPV (Kinrix); DTaP-HepB-IPV (Pediarix); DTaP-IPV / Hib (Pentacel), DT (diphtheria vaccine plus tetanus vaccine) (Sanofi), Hib vaccine (ACTHib); DT (Massachusetts), Hib vaccine (PedvaxHIB); Hib / Hep B (Comvax); Hep A (Havrix), Hepatitis A vaccine, Hep A (Vagta), Hepatitis A vaccine, Hep B (Engerix-B), Hepatitis B vaccine, Hep B (Recombivax), Hepatitis B vaccine; vaccine against HepA / HepB (Twinrix); Human Papillomavirus (HPV) (Gardasil); influenza vaccine (Afluria); influenza vaccine (Fluarix); Influenza vaccine (FluLaval); influenza vaccine (Fluvirin); Influenza vaccine (Fluzone); influenza vaccine (FluMist); IPV (Ipol), polio vaccine, Japanese encephalitis vaccine (JE-Vax); Japanese encephalitis vaccine (Ixiaro); meningococcal vaccine (Menactra); triple viral vaccine (MMR-IIL); MMRV vaccine (ProQuad); pneumococcal vaccine (Pneumovax); pneumococcal vaccine (Prevenar); inactivated poliovirus
(Poliovax), vaccine against polio; anti-rabies vaccine (Imovax); rabies vaccine (RabAvert); rotavirus vaccine (RotaTeq); the rotavirus vaccine (Rotarix), Td vaccine (Decavac); Td vaccine (Massachusetts); DTaP vaccine (Adacel); DTaP vaccine (Boostrix); typhoid (inactivated-Typhim Vi), vaccine against typhus; Typhoid (oral - Ty2l1a), vaccine against typhus; Vaccinia (ACAM2000), vaccine against chickenpox (Varivax); yellow fever vaccine (YF-Vax); Zoster vaccine (Zostavax), and any combinations.
80. The composition according to any one of paragraphs 41 to 79, wherein the ratio of the silk fibroin matrix to the active agent is from about 1: 1,000 to about
1,000: 1.
81. A method for preparing a storage-stable composition according to any one of paragraphs 41 to 80, the method comprising the steps of: a. providing a silk fibroin solution comprising at least one active agent, and b. drying the silk fibroin solution from step (a) to form a solid silk fibroin, thus obtaining a composition in which the at least one active agent retains at least about 30% of its initial bioactivity after storage.
82. The method according to paragraph 81, wherein drying is lyophilization.
83. Method according to paragraph 81, where drying is dry air.
84. The method according to any of paragraphs 81-83, further comprising lyophilizing solid silk fibroin from step (b).
85. The method according to any of paragraphs 81-84, further comprising post-treatment of the composition.
86. The method according to paragraph 85, characterized in that the post-treatment alters the crystallinity of the composition.
87. The method according to paragraph 85 or 86, where the post-treatment constitutes contact with the composition with methanol or ethanol.
88. The method according to any of paragraphs 85 to 687, wherein the post-treatment is subjecting the composition to shear stress.
89. The method according to any of paragraphs 85 to 88, in which post-treatment constitutes subjecting the composition to an electric field.
90. The method according to any of paragraphs 85 to 89, wherein the post-treatment constitutes subjecting the composition to pressure.
91. The method according to any of paragraphs 85 to 90, wherein the post-treatment is in contact with the salt composition.
92. The method according to any one of paragraphs 81 to 91, further comprising reducing the silk fiber in solid state from step (b) by a mechanical device to obtain micronized particles.
93. The method according to paragraph 92, in which mechanical devices are selected from micronization, spraying, grinding, grinding, lyophilization, or any combination thereof.
94. The method according to paragraphs 92 or 93, wherein the micronized particles have a size of about 10 nm to about 1,000 µm.
95. The method according to any of paragraphs 81 to 94, wherein the at least one active agent retains at least about 80% of its initial bioactivity after storage.
296. The method according to any of paragraphs 81 to 95, wherein Storage is carried out for a period of at least about 6 months.
97. The method according to any of paragraphs 81 to 596, in which storage is carried out at a temperature around room temperature up to about 37 ° C.
98. The method according to any of paragraphs 81 to 97, wherein Storage is carried out at a temperature above 37ºC.
99. A method comprising a step of maintaining an immunogenic composition, in which the composition comprises a matrix of silk fibroin, and at least one immunogen distributed therein and in which the immunogen retains at least about 30% of its immunogenicity original when the composition is (a) subjected to at least one freeze-thaw cycle, or (b), maintained for at least about 24 hours at a temperature above 0ºC, or (c) both (a) and (b ).
100. The method according to paragraph 99, in which the immunogen “retains at least about 50% of its initial immunogenicity.
101. The method according to paragraph 99 or 100, wherein the immunogen retains at least about 80% of its initial immunogenicity.
102. The method according to any of paragraphs 99 to 101, wherein the composition is maintained for at least about 1 month.
103. The method according to any of paragraphs 99 to 102, in which the composition is maintained for at least about 6 months.
104. The method according to any of paragraphs 99 to 103, wherein the composition is a film, a fiber, a particle, a gel or a hydrogel.
105. The method according to any of paragraphs 99 to 104, wherein the composition is lyophilized.
106. The method according to any of paragraphs 99 to 105, wherein the composition is micronized.
107. Method according to paragraph 106, wherein the micronized composition is replaced by nanoparticles or microparticles.
108. Method according to paragraph 107, wherein the nanoparticles or microparticles have a size of about 10 nm to about 1,000 µm.
109. The method according to any of paragraphs 99 to 108, wherein the composition further comprises an additive distributed through the silk fibroin matrix.
110. Method according to paragraph 109, wherein the additive is selected from the group consisting of a stabilizing agent, a pharmaceutically acceptable carrier, and any combinations thereof.
111. The method according to paragraph 110, wherein the stabilizing agent is selected from the group consisting of a saccharide, a sugar alcohol, an ion, a surfactant and any combinations thereof.
112. Method according to paragraph 111, in which the saccharide is sucrose.
113. The method according to any of the paragraphs
99 to 112, wherein the composition is maintained at a temperature of about 0 ° C to above room temperature.
114. The method according to any of paragraphs 99 to 113, wherein the composition is maintained at a temperature around the ambient temperature to about 37 ° C.
115. The method according to any of paragraphs 99 to 114, wherein the composition is maintained at a temperature above 37ºC.
116. The method according to any of paragraphs 99 to 115, wherein the composition is kept exposed to light.
117. The method according to any of paragraphs 99 to 116, wherein the composition is maintained at a relative humidity of at least about 10%.
118. The method according to any of paragraphs 99 to 117, in which the immunogen is selected from the group consisting of dead pathogens, live attenuated pathogens, protein subunits and their conjugate, inactivated toxins, synthetic peptides, carbohydrates, antigens, and any combinations thereof.
119. The method according to any of paragraphs 99 to 118, wherein the immunogen is derived from the hepatitis B virus, Haemophilus influenzae type B, poliovirus, Neisseria meningitidis Cc, influenza, chickenpox, Mycobacteria tuberculosis, Calmette-Guérin bacillus , tetanus toxoid,
diphtheria toxoid and Bordetella pertussis.
120. The method according to any of paragraphs 99 to 118, wherein the immunogen is a combination of immunogen selected from the group consisting of DTaP, DTP, DTP HepB vaccine, DTP hepatitis B Hib, DTaP Hepatitis B IPV Hib, and any combinations thereof.
121. The method according to any of paragraphs 99 to 118, wherein the immunogen is live attenuated virus.
122. The method according to paragraph 121, where the, The live attenuated virus is an enveloped virus.
123. Method according to paragraph 122, in which the enveloped virus is selected from the group consisting of Paramyxoviridae, Togaviridae, Orthomyxoviridae, Flaviviridae, Herpesviridae, Rhabdovirus, Retroviridae, and any combinations thereof.
124. The method according to paragraphs 121 to 123, wherein the virus is varicella virus.
125. The method according to paragraphs 121 to 123, wherein the virus is the flu virus.
126. The method according to paragraph 121, where the live attenuated virus causes measles, mumps or rubella.
127. The method according to any of paragraphs 99 to 118, wherein the immunogen is a live, attenuated virus without an envelope.
128. The Method according to paragraph 127, in which the non-encapsulated virus is rotavirus, reovirus, hepatitis virus, rabies virus or poliovirus.
129. The method according to any of paragraphs 99 to 118, & wherein the immunogen is a bacterium.
130. The method according to paragraph 129, in which the bacterium is Mycobcteria tuberculosis, bacillus Calmette-Guérin or Bordetella pertussis.
131. The method according to any of paragraphs 99 to 118, & wherein the immunogen is a bacterial subunit.
132. The Method according to paragraph 131, in which the bacterial Subunit is derived from Neisseria meningitidis type C, Haemophilus influenzae type B, Streptococcus pneumoniae, or Group B streptococci.
133. The Method according to paragraph 131, in which the subunit is a bacterial polysaccharide.
134. The method according to any of paragraphs 99 to 118, wherein O immunogen is a viral subunit.
135. The Method according to paragraph 134, in which the viral subunit is derived from the hepatitis B virus or human papillomavirus.
136. The method according to any of paragraphs 99 to 118, wherein the immunogen is recombinant.
137. The method according to any of the paragraphs
99 to 118, in which the immunogen is a vaccine product selected from the group consisting of anthrax vaccine (BioThrax); BCG (Bacillus Calmette-Guérin) (Tice, Mycobax); DTaP (Daptacel); DTaP (Infanrix); DTaP (Tripedia); DTaP / Hib (TriHIBit); DTaP-IPV (Kinrix); DTaP-HepB-IPV (Pediarix); DTaP-IPV / Hib (Pentacel), DT (diphtheria vaccine plus tetanus vaccine) (Sanofi); Hib vaccine (ACTHib), DT (Massachusetts), Hib vaccine (PedvaxHIB); Hib / Hep B (Comvax); Hep A (Havrix), vaccine against Hepatitis A; hepatitis A (Vagta), vaccine against Hepatitis A, hepatitis B (Engerix-B), vaccine against hepatitis B; Hepatitis B (Recombivax), hepatitis B vaccine; HepA / HepB vaccine (Twinrix); Human Papillomavirus (HPV) (Gardasil); influenza vaccine (Afluria); influenza vaccine (Fluarix); Influenza vaccine (FluLaval); influenza vaccine (Fluvirin); influenza vaccine (Fluzone); Flu vaccine (FluMist); IPV (Ipol), polio vaccine, Japanese encephalitis vaccine (JE-Vax); Japanese encephalitis vaccine (Ixiaro); meningococcal vaccine (Menactra); triple viral vaccine (MMR-II); MMRV vaccine (ProQuad); pneumococcal vaccine (Pneumovax); pneumococcal vaccine (Prevenar); inactivated poliovirus (Poliovax) polio vaccine, rabies vaccine (Imovax); rabies vaccine (RabAvert); rotavirus vaccine (pentavalent), rotavirus vaccine (Rotarix); Td vaccine (Decavac); Td vaccine (Massachusetts); DTaP vaccine (Adacel); DTaP vaccine (Boostrix), typhoid fever (inactivated-Typhim Vi), typhus vaccine, typhoid fever (oral - Ty21a), typhus vaccine; Vaccinia (ACAM2000); Chickenpox vaccine (Varivax); yellow fever vaccine (YF-Vax); Zoster vaccine (Zostavax), and any combinations thereof.
138. The method according to any of paragraphs 99 to 137, wherein the ratio of the silk fibroin matrix to the immunogen is from about 1: 1,000 to about 1,000: 1.
139. A storage-stable immunogenic composition comprising a matrix of silk fibroin and an immunogen distributed therein, in which the immunogen retains at least about 30% of its original immunogenicity when the composition is (a) subjected to at least one freeze-thaw cycle, or (b), maintained for at least about 24 hours at a temperature above 0ºC, or (c) both (a) and (b).
140. The composition according to paragraph 139, wherein the immunogen retains at least about 50% of its initial immunogenicity.
141. The composition according to paragraph 139 or 140, wherein the immunogen retains at least about 80% of its initial immunogenicity.
142. The composition according to any of paragraphs 139 to 141, in which the composition is maintained for at least about 1 month.
143. The composition according to any of paragraphs 139 to 142, wherein the composition is maintained for at least about 6 months.
144. The composition according to any one of paragraphs 139 to 143, wherein the composition is a film, a fiber, a particle, a gel or a hydrogel.
145. The composition according to any one of paragraphs 139 to 144, wherein the composition is lyophilized.
146. The composition according to any of paragraphs 139 to 145, wherein the composition is micronized.
147. The composition according to paragraph 146, wherein the micronized composition is replaced by nanoparticles or microparticles.
148. The composition according to paragraph 147, wherein the nanoparticles or microparticles have a size of about 110 nm to about 1,000 µm.
149. The composition according to any one of paragraphs 139 to 148, further comprising an additive distributed through the silk fibroin matrix.
150. The composition according to paragraph 149, wherein the additive is selected from the group consisting of a stabilizing agent, a pharmaceutically acceptable carrier and any combinations thereof.
151. The composition according to paragraph 150, in which the stabilizing agent is selected from the group consisting of a saccharide, a sugar alcohol, an ion, a surfactant, and any combinations thereof.
152. The composition according to paragraph 151, wherein O saccharide is sucrose.
153. The composition according to any of paragraphs 139 to 152, wherein the composition is maintained at a temperature of about 0 ° C to above room temperature.
154. The composition according to any of paragraphs 139 to 153, wherein the composition is maintained at a temperature around the ambient temperature to about 37 ° C.
155. The composition according to any of paragraphs 139 to 154, wherein the composition is maintained at a temperature above 37ºC.
156. The composition according to any of paragraphs 139 to 155, wherein the composition is maintained under exposure to light.
157. The composition according to any of paragraphs 139 to 156, wherein the composition is maintained at a relative humidity of at least about 10%.
158. The composition according to any of paragraphs 139 to 157, in which the immunogen is selected from the group consisting of dead pathogens, live attenuated pathogens, protein subunits and conjugates thereof, inactivated toxins, synthetic peptides, carbohydrates, antigens and any combinations thereof.
159. The composition according to any one of paragraphs 139 to 158, wherein the immunogen is derived from the hepatitis B virus, Haemophilus influenzae type B, poliovirus, Neisseria meningitidis C, influenza, chickenpox, Mycobacteria tuberculosis, Calmette-Guérin bacillus , tetanus toxoid, diphtheria toxoid, and Bordetella pertussis.
160. The composition according to any of paragraphs 139 to 158, wherein the immunogen is a combination of immunogen selected from the group consisting of DTaP, DTwP, DTwP hepB, DTP Hep B Hib, DTaP Hep B Hib IPV and any combinations of themselves.
161. The composition according to any one of paragraphs 139 to 158, wherein the immunogen is live, attenuated virus.
162. The composition of paragraph 161, where the live attenuated virus is an enveloped virus.
163. The composition according to paragraph 162, in which the enveloped virus is selected from the group consisting of Paramyxoviridae, Togaviridae, Orthomyxoviridae, Flaviviridae, Herpesviridae, Rhabdovirus, Retroviridae, and any combinations thereof.
164, The composition according to paragraphs 161 to 163, wherein the virus is chickenpox.
165. The composition according to paragraphs 161 to 163, where The virus is the flu virus.
166. The composition according to paragraph 161, where the live, attenuated virus causes measles, mumps or rubella.
167. The composition according to any of paragraphs 139 to 158, wherein the immunogen is a live, attenuated, non-enveloped virus.
168. The composition according to paragraph 167, in which the non-encapsulated virus is rotavirus, reovirus, hepatitis virus, rabies virus or polio virus.
169. The composition according to any of paragraphs 139 to 158, wherein the immunogen is a bacterium.
170. The composition according to paragraph 169, in which the bacterium is Mycobcteria tuberculosis, bacillus Calmette-Guérin or Bordetella pertussis.
171. The composition according to any one of paragraphs 139 to 158, wherein the immunogen is a bacterial subunit.
172. The composition according to paragraphs 171, in which the bacterial subunit is derived from Neisseria meningitidis type C, Haemophilus influenzae type B, Streptococcus pneumoniae, or group B streptococci.
173. The composition according to paragraph 171, wherein the bacterial subunit is a polysaccharide.
174. The composition according to any one of paragraphs 139 to 158, wherein the immunogen is a viral subunit.
175. The composition according to paragraph 174, wherein the viral subunit is derived from the hepatitis B virus or human papillomavirus.
176. The composition according to any one of paragraphs 139 to 158, wherein the immunogen is recombinant.
177. The composition according to any of paragraphs 139 to 158, wherein the immunogen is a vaccine product selected from the group consisting of anthrax vaccine (BioThrax); BCG (Bacillus Calmette-Guérin) (Tice, Mycobax); DTaP (Daptacel); DTaP (Infanrix); DTaP (Tripedia); DTaP / Hib (TriHIBit); DTaP-IPV (Kinrix); DTaP-HepB-IPV (Pediarix); DTaP-IPV / Hib (Pentacel), DT (diphtheria vaccine plus tetanus vaccine) (Sanofi), Hib vaccine
(ACTHib), DT (Massachusetts), Hib vaccine (PedvaxHIB), Hib / Hep B (Comvax); Hep A (Havrix), Hepatitis A vaccine, Hepatitis A (Vagta), Hepatitis A vaccine, Hepatitis B (Engerix-B), Hepatitis BB vaccine, Hepatitis B (Recombivax), Hepatitis B vaccine, HepA / Hepatitis B vaccine (Twinrix); Human Papillomavirus (HPV) (Gardasil); Influenza vaccine (Afluria); Influenza vaccine (Fluarix); Influenza vaccine (FluLaval); Influenza vaccine (Fluvirin); Influenza vaccine (Fluzone); Influenza vaccine (FluMist); pneumococcal vaccine; IPV (Ipol), polio vaccine, Japanese encephalitis vaccine (JE-Vax); Japanese encephalitis vaccine (Ixiaro); meningococcal vaccine (Menactra); triple viral vaccine (MMR-II); MMRV vaccine (ProQuad) (Pneumovax); pneumococcal vaccine (Prevenar); inactivated poliovirus, polio vaccine (Poliovax); rabies vaccine (Imovax); rabies vaccine (RabAvert); rotavirus vaccine (pentavalent), rotavirus vaccine (Rotarix); Td vaccine (Decavac); Td vaccine (Massachusetts); DTaP vaccine (Adacel); DTaP vaccine (Boostrix); typhoid (inactivated-Typhim Vi), typhus vaccine, typhoid fever (oral - Ty21a), typhus vaccine; Vaccinia (ACAM2000); Chickenpox vaccine (Varivax); yellow fever vaccine (YF-Vax); zoster vaccine
(Zostava), and any combinations of these.
178. The composition according to any of paragraphs 139 to 177, wherein the ratio of the silk fibroin matrix to the immunogen is from about 1: 1,000 to about 1,000: 1.
179. A method for preparing a storage-stable immunogenic composition according to any one of paragraphs 139 to 178, the method comprising the steps of: a. provision of a silk fibroin solution comprising at least one immunogen; and b. drying the silk fibroin solution from step (a) to form a solid silk fibroin, thus obtaining an immunogenic composition, in which at least one immunogen retains at least about 30% of its original immunogenicity after storage .
180. Method according to paragraph 179, in which drying is carried out by freeze-drying.
181. The method according to paragraph 179, where drying is carried out in dry air.
182. The method according to any one of paragraphs 179 to 181, further comprising lyophilizing solid silk fibroin from step (b).
183. The method according to any of paragraphs 179 to 182, further comprising the post-treatment of the composition.
184. The method according to paragraph 183, in which post-treatment alters the crystallinity of the composition.
185. The method according to paragraph 183 or 184, in which post-treatment is carried out by contacting the composition with methanol or ethanol.
186. The method according to any of paragraphs 183 to 185, wherein post-treatment is subjecting the composition to shear stress.
187. The method according to any of paragraphs 183 to 186, in which post-treatment is subjecting the composition to an electric field.
188. The method according to any of paragraphs 183 to 187, wherein the post-treatment is subjecting the composition to pressure.
189. The method according to any of paragraphs 183 to 188, wherein The post-treatment, is in contact with the salt composition.
190. The method according to any one of paragraphs 179 to 189, further comprising reducing the solid state silk fibroin of step (b) by a mechanical device for obtaining micronized particles.
191. Method according to paragraph 190, in which “mechanical devices are selected from micronization, spraying, grinding, grinding, lyophilization or any combination thereof.
192. Method according to paragraph 190 or 191, wherein the micronized particles have a size of about 10 nm to about 1,000 µm.
193. The method according to any of paragraphs 179 to 192, wherein Oo at least one immunogen retains at least about 80% of its original immunogenicity after storage.
194. The method according to any of paragraphs 179 to 193, wherein Storage is performed for a period of at least 6 months.
195. The method according to any of paragraphs 179 to 194, wherein the storage is carried out at a temperature around the ambient temperature up to about 37ºC.
196. The method according to any of paragraphs 179 to 195, wherein the storage is carried out at a temperature above 37ºC.
197. An immunogenic composition comprising a matrix of silk fibroin, and at least one live, attenuated virus distributed therein; wherein the live, attenuated virus retains at least about 30% of its original infectivity when the composition is (a) subjected to at least one freeze-thaw cycle, or (b) maintained for at least 24 hours at a temperature above 0ºC.
198. The composition according to paragraph 197, wherein the virus retains at least about 50% of its initial infectious stability.
199. The composition according to paragraph 197 or 198, wherein the virus retains at least about 80% of its initial infectious stability.
200. The composition according to any of paragraphs 197 to 199, wherein the composition is maintained for at least about 6 months.
201. The composition according to any of paragraphs 197 to 200, wherein the composition is maintained at a temperature around the ambient temperature to about 37 ° C.
202. The composition according to any of paragraphs 197 to 201, wherein the composition is maintained at a temperature above 37ºC.
203. The composition according to any of paragraphs 197 to 202, wherein the composition is lyophilized.
204. The composition according to any of paragraphs 197 to 203, wherein The live, attenuated virus is an enveloped virus.
205. The composition according to paragraph 204, in which the enveloped virus is selected from the group consisting of Paramyxoviridae, Togaviridae, Orthomyxoviridae, Flaviviridae, Retroviridae, Herpesviridae, Rhabdovirus, and any combinations thereof.
206. The composition according to paragraph 204 or 205, in which the enveloped virus is chickenpox, measles virus, mumps virus, German measles virus, respiratory syncytial virus, yellow fever virus or influenza virus.
207. The composition according to any one of paragraphs 197 to 203, wherein The live, attenuated virus is an non-enveloped virus.
208. The composition according to paragraph 207, wherein said virus without an envelope is rotavirus.
209. The composition according to any one of paragraphs 197 to 208, further comprising an additive.
210. The composition according to paragraph 209, wherein the additive is selected from the group consisting of a stabilizing agent, a pharmaceutically acceptable carrier and any combinations thereof.
211. The composition according to paragraph 210, wherein the stabilizing agent is selected from the group consisting of a saccharide, a sugar alcohol, an ion, a surfactant, and any combinations thereof.
212. The composition according to paragraph 211, wherein said saccharide is sucrose.
213. The cell-free, stabilized virus preparation, comprising a matrix of silk fibroin and infectious viruses distributed therein, in which the virus retains at least about 30% of its original infectivity when the preparation is (a) subjected to at least minus one freeze-thaw cycle, or (b) maintained for at least about 24 hours at a temperature above 0 ° C, or (c) both (a) and (b).
214. The preparation of paragraph 213, where the virus and the silk fibroin matrix are lyophilized.
215. The preparation according to paragraph 213 or 214, wherein the virus retains at least about 80% of its initial infectivity.
216. The preparation according to any of paragraphs 213 to 215, wherein the preparation is maintained for at least about 6 months.
217. The preparation according to any of paragraphs 213 to 216, wherein the preparation is maintained at a temperature around the ambient temperature up to about 37 ° C.
218. The preparation according to any of paragraphs 213 to 217, wherein the preparation is maintained at a temperature above 37ºC.
219. The preparation according to any of paragraphs 213 to 218, wherein The virus is an enveloped virus.
220. The preparation according to any of paragraphs 213 to 218, wherein the virus is the respiratory syncytial virus.
221. The preparation according to any of paragraphs 213 to 218, wherein the virus is an non-enveloped virus.
222. The preparation according to any of paragraphs 213 to 218, wherein the virus is a bacteriophage.
223. The preparation according to any of paragraphs 213 to 218, wherein the virus is a recombinant virus.
224. The preparation according to any of paragraphs 213 to 218, wherein the virus is a viral vector.
225. The preparation of paragraph 224, in which the viral vector is selected from the group consisting of a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector and any combinations thereof.
226. A preparation comprising at least one composition according to any of paragraphs 41 to 80, 139 to 178 or 197 to 212.
227. The preparation according to paragraph 226, wherein the preparation is selected from a group consisting of a tablet, a lozenge, a suspension, a free-flowing powder, an aerosol, a capsule, and any combinations of these .
228. The preparation according to any of paragraphs 226 to 227, further comprising a pharmaceutically acceptable carrier.
229. A package comprising at least one composition according to any of paragraphs 41 to 80, 139 to 178 or 197 to 212, or a preparation according to any of paragraphs 213 to 225 or 226-228.
230. The package according to paragraph 229, in which the container is selected from a group consisting of a vial, an ampoule, a capsule, a tube, a syringe, a vial, a package and any combinations thereof.
231. The package according to paragraph 230, in which the syringe is needle-free.
232. A kit comprising the package according to any one of paragraphs 229 to 231, and a pharmaceutically acceptable solution.
233. The kit according to paragraph 232, which further comprises at least one syringe.
234. The kit according to paragraph 232 or 233, which also includes a disinfectant.
235. A distribution device comprising:
at least one chamber with an outlet, wherein at least one chamber comprises a predetermined amount of composition according to any one of paragraphs 41 to 80, 139 to 178 or 197 to 212 and the outlet provides an outlet for the composition.
236. The device according to paragraph 235, in which the delivery device is selected from the group consisting of a syringe, a dry powder injector, a nasal spray, a nebulizer, an implant and any combination thereof.
237. The device according to paragraph 235, in which the implant is a microchip.
238. The device according to any one of paragraphs 235 to 237, further comprising a trigger for controlling the release of the composition through the outlet.
To the extent that it has not been indicated, it should be understood by those skilled in the art that any of the various modalities described in this document and illustrated can be further modified to incorporate features shown in any of the other modalities disclosed in this document.
The following examples illustrate some embodiments and aspects of the invention. It will be apparent to those skilled in the art that various modifications, additions, substitutions and the like can be carried out without changing the spirit or scope of the invention, and that such modifications and variations are within the scope of the invention as defined in the claims that follow. The following examples do not limit the invention in any way.
EXAMPLES Example 1. MMR vaccine stability on silk fibroin A commercial batch of trivalent vaccine, MMRº IT (live measles, mumps and live rubella virus vaccine) (Merck & Co., Inc., USA) was used. This live, lyophilized virus vaccine contains measles virus from the attenuated Enders' Edmonson strain, Leryl Lynn strain from the mumps virus and rubella virus from the Wistar RA 27/3 strain. Before use, the vaccine is reconstituted in the supplied diluent and each 0.5 mL dose contains not less than 1,000 TCIDso (infectious tissue culture dose) of the measles virus; 12,500 TCIDsº of the mumps virus, and 1,000 TCIDsº of the rubella virus. The manufacturing conditions say that the vaccine must be used within 8 hours after reconstitution and stored at 4ºC or otherwise be discarded. Each dose of the vaccine is calculated to contain sorbitol (14.5 mg), sodium phosphate, sucrose (1.9 mg), sodium chloride, hydrolyzed gelatin (14.5 mg), recombinant human albumin (<0.3 mg ), fetal bovine serum (<1 l ppm), other buffer and media ingredients and about 25 mg neomycin. The product does not contain preservatives. Before reconstitution, the lyophilized vaccine is a light yellow compact crystalline buffer.
A mixture of sterile 9% silk solution (weight / volume) and the reconstituted MMR vaccine was prepared in a concentration of 1: 1 by weight of MMR for silk solution. The films were then molded on a Teflon-coated surface. The films were dried in a sterile chapel for 24 hours at room temperature (RT). A sample of the vaccine reconstituted in solution for 24 hours was also prepared for comparison.
A standard curve was generated by reconstitution of the vaccine, considered as a dilution of 1 logw, and the vaccine solution was then serially diluted in the steps of 0.5 log of 1.5 log of 3.5 log. The silk films were redissolved in an aliquot of water that diluted the final concentration of the vaccine in 1.5 log solution. Vero cells (African green monkey kidney cells, ATCC, Manassas, VA) were cultured to confluence, trypsinized, counted and adjusted to 50,000 cells / mL and seeded in a 24-well plate. Then, 50 ul of the vaccine dilution, redissolved silk film, and reconstituted vaccine stored for 24 hours were added to a well of Vero cells, in triplicate. The virus was replicated in the cell for 3 days, then the RNA from the infected cells was isolated, converted to cDNA and quantified using QgPCR. There is a log-linear relationship between the amount of target RNA and the PCR cycle in which fluorescence increases above the background (Ct limit cycle). The more viable the viruses that are present in the sample, the lower the Ct value.
The results of the qPCR infectivity assay show a linear relationship between the increase in vaccine dilution and the higher Ct value (figure 1). The trial produced the expected results, since the low dilution of the vaccine contained a greater amount of viable viruses, thus producing a lower Ct value. Using this result as a standard curve, the results for the encapsulated silk vaccine sample and reconstituted vaccine sample can be quantified by extrapolating the log: end dilution of their Ct values.
The logiw dilution values were then converted to logiw TCIDso / dose potency values. The TCIDso logo / MMR dose values on silk films were then related to the TCIDso logo / dose of the original dilution into which they were melted (dilution 1, log1io) producing the residual power.
The reconstituted control vaccine stored at room temperature for 24 hours did not produce Ct values, indicating that it had lost almost, if not all, its potency.
The initial potencies recovered from MMR in silk films for measles, mumps and rubella were
75.89%, 58.04% and 62.48%, respectively (Table 1). Table 1. 1: 1 initial power recovery
(weight / weight) of MMR in silk films.
TCID50 / dose) (%)
[measles and gg = CG 9 Rubella O ga ag agÕ) Éssecs) É3á This is a substantial improvement over the reconstituted control vaccine, stored at room temperature for the same period of time, for which the residual potency was below lower limit of detection.
The initial loss of potency in the silk-embedded vaccine was probably caused by reconstitution of the lyophilized vaccine during film preparation, rather than the effect of the vaccine's interactions with silk.
To demonstrate that the most likely loss of activity occurred while the MMR on silk was still in the solution before the films were completely dried, aliquots of lyophilized vaccine were reconstituted in water for 24, 18, 12 and 6 hours at room temperature before inoculation of the cells (figure 2). As can be seen in figure 2, the potency of the vaccine significantly decreases the time that remains in the solution.
Vaccine samples in the solution for 24 hours prior to cell inoculation did not show residual potency for any of the viral components.
Once the films were dried and stored, silk exhibited a stabilizing effect on the vaccine.
As can be seen in figure 3, after 3 months of storage at room temperature, the silk films retained 96%, 92% and 80% potency for the measles, mumps and rubella virus, respectively.
The results indicate that MMR vaccines stored only in unprocessed silk films are capable of expanding the potency of the lyophilized vaccine commercially prepared at room temperature.
Example 2. Addition of additives It has been examined whether the addition of stabilizing additives further increases the thermal stability of the virus.
The vaccine against oral polio virus (OPV), also a live attenuated vaccine, has been extensively studied and has been commercially prepared, with the addition of MgCl2 stabilizer. Studies on the effects of OPV stabilizing additives have been conducted and previously tested stabilizers include sucrose, magnesium sulfate and magnesium chloride
(Mirchamsy et al., 1978; Rapp et al., 1965). MMR on silk films was then prepared from MMR, silk and stabilizer solutions. The initial recovery of MMR in silk films stabilized with 1M MgCl2 :, 1M MgSO.
and 70% sucrose is shown in figure 4. Although MgCl; be an excellent stabilizer for OPV, it had negative stabilizing effects on measles, mumps and rubella. MgSOa provided the best stabilization of the measles vaccine component, but had little effect on mumps and had negative effects on rubella. Sucrose, however, acted as a stabilizer for all three components of the MMR vaccine. In addition, the initial recovery of sucrose-stabilized viral components shows an improvement over the initial recovery of MMR in silk films only (Table 1). In addition, reconstitution of the vaccine in 70% sucrose solution in RT (figure 5) demonstrated greater viral potency maintained over 24 hours than the vaccine reconstituted in water at room temperature (figure 2). In comparison to the MMR vaccine reconstituted in water, the vaccine reconstituted in 70% sucrose also provided better stability at 4ºC and 37ºC (figure 6). The use of stabilizing additives, such as sucrose, can minimize the loss of initial vaccine activity during the preparation of the film. Sucrose can stabilize the vaccine during the film drying process, while MMR and silk are still in the solution.
Example 3. Long-term stabilization of the measles, mumps and rubella vaccine We have shown that the vaccine trapped in silk films and lyophilized silk films are significantly improved in terms of half-life at storage temperatures up to 45ºC.
In the presence of silk, the rate of degradation of viral proteins is reduced.
Biophysical characterization demonstrated that silk provides structural stability for the vaccine by reducing residual moisture during storage and increasing the melting point of viral proteins.
Thus, we present a vaccine stabilization system capable of extending the vaccine's potency without the need for refrigeration.
Silk can be molded into a variety of distribution systems, including films, hydrogels, microspheres and microneedles, capable of being adapted for stabilization and specific distribution needs.
This material system can be used ex vivo or in vivo as distribution vehicles due to the biocompatibility and FDA approved history of using silk in biomedical devices.
Residual vaccine activity after immobilization on silk films Silk films were prepared with a silk vaccine weight ratio of 1: 1. The initial recovered potency of the vaccine was determined directly after the films were prepared to determine how much infectivity of the vaccine. vaccine was lost during the film making process.
In order to incorporate the vaccine into the silk solution, the lyophilized vaccine must be reconstituted.
The lyophilized vaccine was reconstituted immediately before inoculation of the cells.
Once the lyophilized vaccine has been reconstituted, potency decreases rapidly (Galazka, 1998; WHO 2006) and according to the manufacturer's specifications, the MMR vaccine must be used within 8 hours after reconstitution or otherwise discarded.
Once completely dry, the films containing the same amount of lyophilized vaccine were dissolved in sterile water and the solution was added to Vero cells for the potency test.
The potency results of the silk films were compared with the potency of the lyophilized vaccine to establish an initial recovered potency.
The observed initial residual potency of MMR in silk films is summarized in Table 2 with 84.7%, 73.9%, and 87.0% residual power of the measles, mumps, rubella and components vaccine, respectively.
Table 2. Comparison of the initial viral potency recovered from the silk films that encapsulate vaccine and lyophilized silk films Form of silk in the Viral Component Power recovered initial vaccine (%) MMR in Measles film 84.7 + 6.40 Mumps silk 73, 9 + 2.24 Rubella 87.0 + 2.23 MMR in Measles film 94.7 + 0.34 freeze-dried silk Mumps 89.6 + 1.30 Rubella 98.4 + 0.35 o HDÊOIA 98.4 + 0 , 35 Sufficient vaccine encapsulating silk films were manufactured using this air drying method and stored during a 6-month study to assess long-term stability at four different temperatures (4ºC, 25ºC, 37ºC and 45ºC). However, the hypothesis that most of the loss of viral potency observed with the films occurred while MMR in silk was in solution for the preparation process.
To verify this hypothesis, the lyophilized vaccine was reconstituted in the diluents provided by the manufacturer and the solutions were stored at 4ºC, 25ºC and 37ºC (figure 8A-8C). Potency measurements were made after 6 hours, 12 hours, 18 hours and 24 hours after reconstitution.
As predicted, the vaccine rapidly loses potency within hours in solution and storage at higher temperatures resulting in a faster decline in potency.
In comparison with the drying time of the films, in 12 hours in the solution at 4ºC, 53.4%, 73.4%, 76.3% of residual power remain for the measles, mumps and rubella components, respectively.
After 12 hours at 25ºC, only 57.8%, 53.1%, 46.6% of residual measles, mumps, rubella power remained, respectively.
A more dramatic reduction was observed for the vaccine reconstituted for 12 hours at 37ºC as only 36.5%, 46.6% and 23.9% of potency against measles, mumps and rubella were recovered, respectively.
Based on these results, it was postulated that reducing the time the initial vaccine remained in solution could improve recovery.
Therefore, MMR in lyophilized silk films was prepared to shorten the stage of the MMR solution in silk.
The lyophilization process significantly improved the long-term thermal stability of the vaccine in silk films.
As shown in Table 2, compared to the initial potency recovered from air-dried silk films, lyophilized films improved the recovery of measles, mumps and rubella, to 94.7%, 89.6%,
98.4%, respectively.
Thermostability of silk films that encapsulate vaccine
The vaccine stability was quantitatively expressed as the observed residual potency of the films after storage.
Residual potency was measured and compared with the initial residual potency (Table 2), to demonstrate the stability of the vaccine.
When measuring the residual potency of all viral components of the vaccine stored in silk films over six months, with the exception of storage at 4ºC, the general trend showed that silk films improved the stabilization of measles viral particles, mumps and rubella, by displaying higher potencies when compared to the manufacturer's freeze-dried vaccine stored at the same temperature.
Figures 9A-9D show the comparison of the residual potency of the measles component of the vaccine for silk films and the lyophilized powder MMR vaccine stored for six months at 4ºC, 25ºC, 37ºC and 45ºC, With the exception of storage at 4ºC, the films showed higher residual potency of the vaccine.
Even at 4ºC, the residual power of the silk films was similar to that of powder MMR.
As long as the residual potency of the powder does not fluctuate, silk films exhibited greater variation in the potency measured at that temperature.
During the first 3 months, the silk films overcame the dust with greater residual power recovered.
In the past 3 months, silk films have shown a slight decrease in residual power, while the powder has remained relatively constant. At the end of the six-month study, the residual potency of the measles component of the MMR vaccine stored in the silk films was 87.2% compared to 92.2% for the powder. Silk films, however, show better residual potency against measles when stored at 25ºC, 37ºC and 45ºC. When stored at 25ºC, silk films showed greater potency recovered at each point of time and at the end of the six-month period they presented 83.9% potency compared to 74.5% recovered for Oo powder.
The stabilization provided by silk was even more evident for the films and powder stored at elevated temperatures, 37ºC and 45ºC. At a temperature of 37ºC, silk films showed a dramatic improvement in the stability of measles infectivity over the course of six months, resulting in 56.5% of recovered potency compared to 9.9% from the powder. In the case of films and powder stored at 45ºC, the measles component of the vaccine lost all potency after 20 weeks of storage, while the silk films maintained an activity of 53.5% after 24 weeks. Similar trends were presented for both mumps components (figures 10A-10D) and rubella components (figures 11A-11D). Again, similar to the results for the measles component, the silk films exhibited more stabilization of the mumps component at 37ºC and 45ºC. At both temperatures, the silk films exhibited a slight decrease in residual activity during the first month of storage, but after the first month, the decrease in residual potency was much slower than the reduction of the stored powder vaccine activity. At the conclusion of the study, silk films stored at 37ºC retained 61.3% of mumps infectivity, while the powder retained 13.0%. After 6 months of storage at 45ºC, the silk films recovered 59.6% of the mumps' potency, while the powder lost all potency after 20 weeks. The rubella component exhibited similar trends in potency. For silk films stored at 4ºC, 25ºC, 37ºC and 45ºC, 88.4%, 78.4%, 60.3% and 58.3% of residual power were recovered, respectively. With the exception of powders stored at 4ºC, these results show that silk provided improved stabilization and maintenance of potency over the powder. The residual potency of the powder at 4ºC, 25ºC, 37ºC and 45ºC was 89.4%, 56.3%, 15.3% and 0%, respectively.
Although lyophilized silk films were initially prepared to improve the initial recovery of the vaccine lost during the film making process, they provided even greater stabilization of the vaccines at elevated temperature.
The residual potency of the measles, mumps and rubella components stored in the lyophilized silk films is shown in figures 12A-12D, 13A-13E and 14A-14D, respectively.
Regardless of the storage temperature, lyophilized films provided comparable levels of stabilization for all components of the vaccine.
While the lyophilized silk films showed improved stabilization and residual power recovered at all temperatures, the level of stabilization was more dramatic at higher temperatures.
After 6 months of storage, the lyophilized silk films retained 85.2% and 85.1% of the measles residual power at 37ºC and 45ºC, respectively.
Likewise, 86.2% and 86.0% of mumps potency remained after 6 months, when stored at 37ºC and 45ºC, respectively.
The rubella component appeared to be more stabilized by lyophilized silk films, since 88.2% of the viral potency remained after 6 months of storage at 37ºC, while O storage at 45ºC still resulted in the retention of 87.5% of the potency viral.
Evaluation of thermostability by degradation kinetics The rate of degradation, Kows, for each temperature was calculated by linear regression of the virus log titre drop against the exposure time in weeks. The slopes of the resulting curves represent the degradation rates. The half-lives of the virus (t1 / :) at each temperature and the respective 95% confidence interval were calculated from the Kkows AND their standard errors. The virus half-life is the expected half-life or time required for the average power to drop to 50% of the initial value. The estimated degradation rates and corresponding half-lives for each viral component and vaccine encapsulation method are summarized in Table 3 and the half-lives were plotted against temperature in figures 16A-16C. The degradation rates of the three systems in relation to the tested temperature range were also well adjusted in the Arrhenius graph (figures 14A-15C). As can be seen from the graph, the values for the slope of the powdered vaccine form were consistently higher than those of both silk systems, Oo which indicates the rates of dust degradation grew more rapidly with increasing temperature. storage.
Table 3. Summary of expected degradation rates and half lives of powder vaccine and vaccines encapsulated in silk film and lyophilized silk film Measles EEE Temperatur Predicted half-life rate system, ti, the (ºC) degradation vaccine, Kors (weeks) (Limit
(logo lower, upper) TCIDs./weeks) TT EEBOL TO 009 CEILING 000S TT TEITS 6 weeks (169.2, & so Films 0.0136 + 0.0025 - 96.6 weeks (81.6,: e. oea AA ATA A à o = films 0.009 +. 0.0001. 135.3 weeks (133.8, Sec 1 Tofilized dog e. 138.3) S SO POWDER 0.0331 + 0.0037 47.1 weeks (42 , 4, 56.6) Films 0.0123 + 0.0002 100.8 weeks (99.1, 104.0) Films 0.0098 + 0.0013 123.8 weeks (109.8, lyophilized 151.8) : 37 POWDER O 00 0/1287 + 0/0004 9.4 weeks (9.4, 9.5) O. Films —— 0.0458 + 0.0034 21.9 weeks (20.4, O & oo BB , OI à. Ão Sos “Films 0.0131+ 0.0008 93.8 weeks (88.4, E“. Lyophilized st 104.6) * AND THE 45 DUST 0.139 + 0.0261 5.1 weeks (4, 3, 6.7) Films 0.0401 + 0.0010 19.8 weeks (19.4, 20.8) Films 0.0128 + 0.0019 294.9 weeks (82.6, lyophilized 119.4) Mumps Temperatur Predicted Half-Life Rate System, ta, (ºC) vaccine degradation, Kors (weeks) (Threshold (10910 lower, upper) TCIDs./weeks)
4. POWDER 1 0/0173 + 0.0005 102.3 weeks (99.4, A A, EE 108.0) Ao ia - Films 0.0302 + 0.005. 51.3 weeks (44.0, EA DEE ANTA A BBDO E ARO Films —.0.0091 + 0.0018 152.1 weeks (127.0, O lyophilized Ss a and PS OR Sos and IEA 25 POWDER 0, 0677 + 0.0001 26.5 weeks (26.5, 26.6) Films 0.0408 + 0.0056 34.3 weeks (30.2, 42.6) Films 0.0106 + 0.0005 129.3 weeks (123.5,
2. lyophilized =: 140.4) GOOD BT: O, 1435 + 0/0052 10.7 weeks (10.3, tas O and VAL, 5) OO If ES = Films -. .0.0439 + 0.001. 25.7 weeks (25.1, AEE En A NEL ui to SERIOUS A DA A = Films - 0.0129 + 0/0025 106.0 weeks (88.8, freeze dried 0 0 TAO / AD í 45 POWDER 0.1967 + 0.0357 8.2 weeks (6.9, 10.7) Films 0.0384 + 0.0021 28.6 weeks (27.1, 31.6) Films 0.0121 + 0.0027 111 , 9 weeks (91.5, lyophilized 152.7) Rubella Temperatu- Predicted Half-Life Rate System, ta, ra (ºC) vaccine degradation, Kors (weeks) (Limit (10910 lower, upper)
TCIDs./weeks) AND DO 10/0119 + 0.0022 "124.5. Weeks - (105.1, aa EAN A to O ABB a) OO E oo Films 0.0101 + 0.0012 123.6. weeks (110.5, O o DM A o Films. 0.0036 + .0.0001l 383.7 weeks (373.3, A of lyophilized AC Aa a oo 2 if 25 POWDER 0.0521 + 0.0021 29, 5 weeks (28.3, 31.8) Films 0.022 + 0.0024 56.8 weeks (51.2, 68.0) Films 0.0121 + 0.0012 117.3 weeks (106.7, 2 lyophilized = : 2 138.5) to: 37 BB -0.1192 + 0.0006 - 10.9 weeks (10.8, EE EA A = spin. RA See 11.0) and Naa RA, in SE “Films - 0 / 0387 + 0.0004 28.9 weeks (28.6, ”EE So o s es EIRO 29.5) a SS =« = Films 0.0144 + 0.0037 99.3 - weeks (79.0 , ec ccrdtofilizados 0 e 139.8) oOO 45 POW 0.1681 + 0.0298 8.2 weeks (6.9, 10.6) Films 0.0387 + 0.0003 27.3 weeks (27.1, 27.7) Films 0.0144 + 0.0025 97.1 weeks (82.8, lyophilized 125.9)
With the exception of samples stored at 4ºC, vaccine systems encapsulated in dry and freeze-dried silk exhibited lower degradation rates compared to powdered vaccine at
25ºC, 37ºC and 45ºC for the measles, mumps and rubella components.
Decreased degradation rates correspond to an increase in expected half-lives.
From the table, trends appear similar for all viral components and show that at high temperatures, silk films increased the vaccine half-lives through powder formulation, with freeze-dried silk films showing dramatic improvements in the stockings lives of vaccines in relation to powder and silk films.
In addition, as the storage temperature was increased, the rates of degradation and expected half-life increased and decreased significantly, respectively, for both powder and silk film formulations.
The lyophilized silk film samples, however, maintained rates of slow degradation maintained at all storage temperatures tested.
Evaluating the change in the rate of degradation of the measles component from 4ºC to 45ºC, the powdered vaccine exhibited a 1.444% increase in the degradation rate from 0.0136 + 0.0025 to 0.0401 + 0.0010 logo TCIDso / weeks , while MMR in silk film and MMR in lyophilized silk film had an increase of 195% from 0.0139 + 0.0261 to 0.009 + 0.0005 TCIDso / weeks and 42% increase of 0.0128 + 0.0019 to 0.009 + 0.0001 log TCIDso / Weeks in the rate of degradation in relation to the temperature range, respectively.
The mumps and rubella components show similar trends.
With the exception of storage at 4 ° C, powder vaccine data show an expected measles half-life of 178.6 weeks, greater than 96.6 weeks for silk films and 135.3 weeks for lyophilized silk films, silk films and lyophilized silk films exhibited a much more dramatic increase in the half-life of the virus at elevated temperatures.
The difference is specifically evident in the expected half-life of the virus at
37ºC and 45ºC.
At 35ºC, the 21.9 weeks of silk film half-life was a significant improvement over the 9.4 weeks provided by the powder, but lyophilized silk films dramatically increased the half-life to 93.8 weeks.
Storage at 45ºC provided similar results to the powder, silk films and lyophilized silk films showed a half-life of 5.1, 19.8 and 94.9 weeks, respectively.
Temperature dependence on vaccine degradation rates was further assessed using regression analysis.
From the graph of falling virus titration against time (not shown) for powder, silk film and lyophilized silk film systems, the data can be reasonably approximated by a straight line, exhibiting a zero order pseudo behavior .
The graph of the virus titration drop against time corresponds and displays trends similar to the residual power curves.
As can be seen from the graph, a linear response of changes in viral concentration suggests that the degradation mechanism follows zero order kinetics.
Although employing a more careful analysis of the data, the linearity of the drop in virus titration against time decreases over long time intervals.
These data suggest that the rate of degradation may deviate from zero-order behavior and decrease over long periods of time.
The kinetics model of vaccine degradation over time is therefore considered to be a zero pseudo-order model.
Pseudo reaction orders are found in drug stability studies as only the variation in the concentration of the active pharmaceutical ingredient is normally monitored over time, while other reagents and buffer components are in large excess, although not analyzed (Zhou and others, 2009). Thus, a first-order reaction may appear to be a zero-order or zero-pseudo-order reaction.
In zero order reactions, the reaction rate does not depend on the reagent concentration and is constant.
The zero order rate equation is as follows: sk and the data obtained at each temperature were adjusted using the following equation: Saka o where C, is the power measured in the TCIDso log at time t, C, is the measured power at time zero, k ,, is the rate of degradation determined by linear egress and t is the storage time in weeks.
The expected half-life, & is the time required for the average power to decrease to 50% of the initial value.
The half-life for each temperature was estimated by the equation: 1.22 2 2hkors The rates of thermal degradation of the three vaccine systems could follow the expression of Arrhenius' law regarding absolute temperature as shown in the following equation: k ( T) = Ae "
where k is the rate of thermal degradation, A is the pre-exponential factor, E is the activation energy, R is the gas constant and T is the absolute temperature.
A graph of degradation rates against the reciprocal of absolute temperature can show degradation trends “dependent on temperature over wide temperature ranges.
Arrhenius graphs show that the powdered vaccine has the steepest slope, which indicates an increased dependence on the temperature of degradation in relation to both silk systems.
By comparison, the shallower slopes of silk systems demonstrate that silk greatly reduces the rate of degradation of the vaccine at elevated temperatures and is capable of maintaining the potency of the vaccine at elevated ambient temperatures.
As can be seen in the comparison of the half-life of the three vaccine systems, the improvement in the half-lives of the silk systems becomes more evident and dramatic as the storage temperature increases.
Effect of residual moisture processing conditions in vaccine systems The MMR vaccine is supplied in lyophilized form and the presence of stabilizers in the vaccine to reduce the moisture content has significantly improved its thermal stability (Galazka et al., 1998). The useful life of lyophilized vaccines depends both on adherence to the cooling chain and on maintaining a low residual moisture content.
As the storage temperature increases, so does the amount of water in the air.
The MMR on silk films was fabricated and air-dried under ambient conditions, therefore, it had a higher initial residual humidity than both the lyophilized powder MMR and the MMR on lyophilized silk films.
The residual humidity of the MMR on silk film calculated immediately after determining a dry state was determined to be 4.42% + 0.65%. The residual moisture of powder MMR and MMR in lyophilized silk films was calculated to be 2.39% + 0.23 and 1.89% + 0.13, respectively.
With the exception of MMRs on silk films, storage of lyophilized vaccine systems after six months at 4 ° C produced a very small change in residual moisture. In fact, the residual moisture of the films stored and lyophilized for six months at all temperature points exhibited very little aberration from the initially measured value, exhibiting only a 6.9% net increase in residual moisture from the initial value to the value highest recorded at 45ºC. Due to processing conditions, MMRs in silk films showed higher residual moisture, but the net increase to the highest residual moisture recorded in six months of storage at 45ºC was only 30.1% compared to the increase in 61.5% shown in the powder MMR system. The residual moisture content of the vaccine systems corresponded to the residual potency. At high temperatures, powder MMR exhibited greater power losses than silk films, correlating well with the greater increase in residual moisture. Likewise, the minimal increase in residual moisture from MMRSs in lyophilized silk films has resulted in greater viral power retention.
Table 4. Comparison of residual moisture in MMR powder, MMR in silk films and MMR in lyophilized silk films under specific storage conditions. “Vaccine system ——Condition. residual moisture (%) powder MMR storage At t = 0
(Initial condition) 2.39 + 0.23
After 6 months at 4ºC 2.37 + 0.15
After 6 months at 25ºC 2.73 + 0.54
After 6 months at 37ºC 3.52 + 0.35
After 6 months at 45ºC 3.86 + 0.28
MMR in silk films At t = 0 1.89 + 0.13 lyophilized (Initial condition)
After 6 months at 4ºC 1.81 + 0.20
After 6 months at 25ºC 1.97 + 0.43
After 6 months at 37ºC 1.83 + 0.35
After 6 months at 45ºC 2.02 + 0.52
MMR in silk films At t = 0 4.42 + 0.65
(Initial condition)
After 6 months at 4ºC 5.26 + 0.51
After 6 months at 25ºC 5.47 + 0.53
After 6 months at 37ºC 5.53 + 0.70
After 6 months at 45ºC 5.75 + 0.91 Structural characterization of silk vaccine systems In order to investigate how silk provided improved thermostability to vaccines, physical measures were studied using calorimetry and light scattering.
DSC (Figure 17) was used to demonstrate that the silk encapsulant provided stabilization by increasing the glass transition (Tg) of the vaccine.
The solid-state DSC of lyophilized silk films showed a Tg at 178ºC.
The DSC thermogram of powder MMR showed a Tg of 68.9ºC, while the MME in lyophilized silk films showed a Tg of 89.2ºC, as well as two peaks at 116.6ºC and 164.8ºC, which could indicate a Tm, melting temperature and Td, degradation temperature.
It is not clear whether the Tg shift was due to structural stabilization by silk or interaction between silk and the various excipients present in the vaccine sample.
The vaccine was then purified to remove added excipients.
The resulting solution contained purified viral particles suspended in sterile, nuclease-free water.
As the viral sample is a liquid solution, nano-DSC was performed on these samples.
The nano-DSC thermogram (figure 18) of the viral particles purified in water showed a Tm at 16.8ºC, indicating that the viral proteins were subjected to a conformational change.
The solution of viral particles purified on silk showed a high Tm at 68.3ºC.
Although the nano-DSC range does not extend far enough to show the Tg of the silk, a silk solution thermogram is still shown to illustrate that none of the Tg values can be attributed to a change in the structure of the silk.
To investigate whether the Tm corresponded to the denaturation of the viral particles due to aggregation, the size of the viral particles was analyzed by DLS (figure 19). The weighted average effective diameter of a bare viral particle is about 250 nm.
This is consistent with reported measles, mumps and rubella values (Russell et al., 1967; Hall and Martin, 1973). The results indicate that the purified virus solution showed an increase in the effective mean diameter around 16ºC, indicating the presence of protein aggregation.
The DLS of the viral particles in the silk solution, on the other hand, does not show an increase in the effective mean diameter up to about 70ºC, showing the aggregation of the protein at a higher temperature.
The results of the DLS correspond well to the results of the nano-DSC as the aggregation detected by light scattering occurs within the temperature range of the protein unfolding measured by DSC.
Vaccine release from silk films, lyophilized silk film, silk hydrogels and silk microspheres In order to demonstrate that silk provides not only the stabilization of the vaccine, but also control over the vaccine release kinetics, release studies have been conducted. made with a variety of silk formulations.
Each silk formulation (film, lyophilized film, hydrogel and microsphere) contained the same initial amount of vaccine.
Cumulative release profiles of the vaccine encapsulated in silk films and lyophilized silk films are shown in figures 20A and 20B.
In vitro release studies were conducted for these two systems with individual films placed between two blocks of gelatin hydrogels, allowing the release of vaccine as the silk films dissolve in the hydrogels.
The vaccine trapped in silk films prepared from an 8% silk solution (weight / volume) exhibited a slightly sudden release, typical of diffusion release.
In the last 6-hour collection, almost all of the encapsulated vaccine was released as 92.43% of the vaccine was recovered and active.
The silk films prepared with 4% (weight / volume) showed a similar release profile, except that the sudden release was faster as the released mass approached the release more quickly.
Lyophilized silk films showed a more pronounced bursting effect as 8% silk films released 44% and 4% films released 56% of loaded MMR within 10 minutes of placing in the hydrogel.
The lyophilized silk films released almost all of the loaded MMR within 90 minutes.
Silk hydrogels and microsphere preparations exhibited a much slower release in comparison, on the order of days (figures 21A-21B). Silk hydrogels at 4% and 8% extended the vaccine release to 8 days.
In addition, 16% silk hydrogels were able to prolong the additional release as only 73.53% of the vaccine was released on day 8. The vaccine released from the silk microspheres showed greater potential as an extended and extended release system.
Likewise, the increase in the silk concentration of the microspheres delayed the release rate, the silk microspheres released 16% 65.35% of the vaccine loaded on day 8. The relative linearity of the release of the 16% silk microspheres is also of interest, as the regression coefficient (R ) for the curve was 0.988, indicating a release close to zero order.
The biophysical characterization of the vaccine against measles, mumps and rubella, through the use of calorimetry and light scattering, allowed a description of the process of physical stabilization of the virus as a function of the high temperature during the storage of the vaccine.
Due to the temperature sensitivity of vaccines, the vaccine distribution and storage process is fragile, since these issues are often accompanied by a considerable logistical cost (Zweig, 2006). It is known that the immobilization of bioactive molecules, such as enzymes, leads to an increase in stability while improving handling.
Immobilization is important, since it is important to maintain constant environmental conditions in order to protect bioactive molecules against changes in pH, temperature and ionic resistance (Kumakura, 1995). The chemistry, structure and assembly of silk generates a unique nanoscale environment and makes this protein polymer an attractive candidate for the stabilization of bioactive molecules over extended periods of time (Jin and Kaplan, 2003). Without chemical processing, silk can be used to retain bioactive molecules in the amphiphilic domains, self-assembling from the aqueous solution.
MMRº II, a live, attenuated measles, mumps and rubella virus vaccine is provided as a lyophilized preparation to be reconstituted at the time of use.
Before reconstitution, the vaccine needs to be stored at 2 to 8ºC and will be stable for 24 months, once reconstituted they must be used within 8 hours.
The WHO requirement for heat stability of measles, mumps and rubella vaccines employs two stability indices: 1) the vaccine must retain at least 1,000 live virus particles in each human dose, after incubation at 37ºC for seven days, and 2), the virus titration should not decrease by more than 1 log during storage (WHO, 1982; WHO, 1994). Live virus vaccines, unlike other forms of vaccine, depend on their immunogenicity to establish an adequate immune response, which requires the maintenance of a sufficient number of live virus particles.
The storage of these thermally labile viral particles requires the addition of stabilizers.
Each dose of MMRº II is stabilized in 14.5 mg of sorbitol, sodium phosphate, 1.9 mg of sucrose, sodium chloride, 14.5 mg of hydrolyzed gelatin, <0.3 mg of recombinant human albumin, <1l ppm fetal bovine serum, other buffer and media ingredients, and about 25 µg neomycin.
Excessive exposure to temperatures above recommended storage conditions can damage vaccines in several ways, most notably altering the tertiary structure of viral proteins, reducing viral infectivity, thereby decreasing the potency of the vaccine (Chen and Kristensen, 2009). Changes in protein structure can lead to altered cell aggregation and absorption, affecting vaccine activity (Brandau, et al., 2003; Manning et al., 1989, Middaugh, 1996). Mumps and measles belong to the paramyxovirus family, characterized as an enveloped virus containing the nucleocapsid that covers the single-stranded negative sense viral NRA surrounded by fusion glycoproteins (F) and hemagglutinin (H) expressed on the virus surface (figure 22A ) (Kingston et al., 2008; Woelk et al., 2002). Likewise, rubella belongs to the Togavirus family and is a virus enveloped with two glycoproteins specific for the E1 and E2 viruses, which surround an icosahedral nucleocapsid covering a single-strand positive sense viral RNA (Dorsett et al., 1985, Nakhasi and others, 1991).
The paramyxovirus infection method involves binding the virus to the host cell's CD46 and CD1I50 receptors through the intersection of both the hemagglutinin (H) glycoprotein (F) glycoprotein (Figure 22C) (Wild et al., 1991, Malvoisin and Wild,
1993; Moss and Griffin, 2006). The fusion of virus and cell allows viral entry and release of viral nucleic material into the cell.
The main cause of viral inactivation is the disruption of viral surface proteins and stresses such as elevated temperatures can induce conformational changes in viral proteins (Rexroad et al., 2006, Ausar et al., 2006). These conformational changes can affect the stability of the virus through the induction of viral particle aggregation that prevents cell binding and absorption, thus leading to virus inactivation (Figure 22D) (Ohtake et al., 2010). The development of a vaccine formulation that is resistant to heat damage and improves the thermal stability of the vaccine would have great benefits including extending the life span, reducing vaccine loss and reducing dependence on cooling chain requirements.
The improvement in the stability of the vaccine provided by the silk protein was more pronounced at elevated temperatures of 37ºC and 45ºC, while the stability was comparable or slightly better than the powder form manufactured and stored at 4ºC and 25ºC.
The stabilized vaccine is lyophilized with a variety of excipients that, according to the manufacturer, must remain stable and active for at least two years.
Vaccine deterioration occurs, however, when the cooling chain is broken and the vaccine is stored above the refrigeration temperature.
In such cases, silk would be sufficient to provide stability for the vaccine to maintain stability over a range of environmental conditions.
The lyophilization of MMRs on silk films improved the potency of the initial vaccine recovered, the longer the viral particles remained in the hydrated state, the more likely they would be exposed to degradation reactions, such as deamidation hydrolysis that can contribute to instability (Li , 1994). The improved and continuous stabilization provided by lyophilized silk films for more than six months in storage may also be due, in part, to the storage conditions of the lyophilized films.
While regular silk films were stored in Eppendorf tubes, lyophilized films were stored in vacuum sealed bottles with low residual moisture content,
The evaluation of experimental potency data by kinetic unfolding and degradation models serves to illustrate the projected accelerated stability of different vaccine systems at selected temperatures, while also relating potency data to temperature-induced conformational changes to be explained by biophysical characterizations.
Under accelerated stability study conditions, the intrinsic stability of pharmaceutical protein products is often dramatically reduced.
At elevated temperatures, protein unfolding rates increase and more chemical interactions involved in protein destabilization are accelerated compared to lower temperatures (Creighton, 1990). The acceleration of the degradation process through storage at elevated temperatures, allows the evaluation of silk as a suitable candidate stabilizer to inhibit the inactivation process.
Examination of potential data suggests that the degradation observed by the three vaccine systems can be adjusted to a zero order kinetics system.
The observation of a concentration-time profile of reactions of zero, first and second order shows that the zero order kinetics always predicts the highest degree of composition as a function of the time between the three.
Thus, when predicting the order of a reaction, assuming a kinetic model of zero order, it will predict the maximum amount of degradation that may occur at some point in the future (Zhou et al., 2009). Therefore, assuming that the degradation of the MMR virus is of the zero pseudo-order, using zero-order kinetics to model the degradation profile,
we predict the most conservative estimates for the half-life of the vaccine film encapsulated in silk and lyophilized silk film systems.
The general trend observed for all three virus components was that both types of silk films decreased virus degradation rates and lyophilized silk systems exhibited the best degradation rates and, therefore, a longer half-life between the three systems, while the powdered form of the vaccine degraded more quickly at all temperature points tested.
The deviation of this behavior was observed in samples at 4ºC as powder vaccines show a lower rate of degradation with a high expected half-life in non-lyophilized silk films.
One possible explanation for the results is that the powdered vaccine has the advantage of the lyophilized preparation over normal silk films.
During the preparation of the film, additional moisture was introduced into the encapsulated vaccine oO which increases intermolecular mobility and the possibilities for degradation within the silk films compared to the powder vaccine provided by the manufacturer.
Undoubtedly, silk films provide greater stability at high temperatures, even with the disadvantage of additional moisture.
However, the lyophilized powder vaccine was formulated to remain stable in the optimal temperature range of 2 to 8ºC. This advantage of lyophilization may also explain the success of lyophilized silk films in stabilizing the vaccine, since they provide stability provided by both silk and lyophilization.
In addition to the kinetic studies performed using the power data, biophysical characterizations using calorimetry and light scattering were performed to confirm the results. Due to the high glass transition temperature of the silk fibroin, 178ºC, the silk protein is thermodynamically stable, once self-assembled in the conformation of fB-leaf. These characteristics provide an environment for stabilizing the vaccine. The vaccine-silk solution consisted of vaccine molecules in the native form and silk fibroin, mainly present in random spirals. Once the films are shaped, there is some conversion of the fibroin to fB-leaves, which contain hydrophobic regions, while the random spirals contain the most hydrophilic regions. Vaccines appear to be stabilized in this environment, possibly due to interactions with the fibroin chains or restrictions on chain mobility (figure 21B). The DSC in the state (figure 17) showed a Tg of powder MMR at 68.9ºC. This value, however, may not be correct, as it may not reflect the Tg and corresponding structural change of the viral particles itself, but instead an average value of the contributions of the various excipients of the protein and stabilizers already present in the formulation of the vaccine. Powder MMR.
MMR in silk film showed a Tg at 89.2ºC, indicating a change in the Tg of the vaccine, due to the presence of silk.
The MMR thermogram on lyophilized silk film also showed the presence of two exothermic peaks at 116.6ºC and 164.8ºC.
The peak at 116.6ºC was most likely a Tm, indicative of protein breakdown, while the second peak was degradation, Td.
The same cannot be determined if unfolding and degradation contribute to viral proteins or the various excipients present in the vaccine formulation.
Therefore, it is difficult to say conclusively that The increase in Tg of the vaccine in the presence of silk directly contributed to the structural stability of the viral particles.
In order to clarify the situation, the vaccine was purified to remove excipients.
Since the result of the purification is a liquid preparation, the viral particles are in a less stable environment.
Therefore, the solution of viral particles was stored at -80ºC until used.
Tm by nano-DSC appears when a protein unfolds, exposing the hydrophobic and hydrophilic regions in the aqueous buffer solution.
Adjacent hydrophobic protein molecules will aggregate to protect these regions from the surrounding aqueous solution.
Since the unfolded state of the protein has more surface area than the native state, the degree of preferential exclusion offered by the silk stabilizing agent from the less structured state would increase the chemical potential of this stabilized form, even above that of the native state ( Brandau et al., 2003). This increase in stability can be reflected in the increase in the midpoint of the protein split transition, Tm.
The high Tm of the vaccine solution encapsulated in silk is due to the structural stabilization provided by silk to prevent denaturation of viral proteins and aggregation.
The Tm value at 16.8ºC is probably due to the breakdown of viral surface glycoproteins (measles and mumps FeN and rubella El and E2) due to the excessive heat applied to the viral particles.
This denaturation probably leads to the aggregation of the viral particles (figure 22D), preventing them from binding and fusing with animal cells (figure 22C), leading to the loss of the infectivity of the viral and vaccine particles as a whole.
This associated aggregation is shown in the DSC thermogram, as the marked change in the heat flow immediately after Tm.
It seems that aggregation, an exothermic process,
it is a direct result of the endothermic unfolding of the protein. The amplitude of the Tm peaks is probably a result of the combined contribution of the unfolding of several proteins present in the sample. In addition, protein aggregation can also contribute to the great peaks of overlap with denaturational endotherm (Packer et al., 2002). The infectivity of MMR depends on the conformational stability of viral proteins (Kissman et al., 2008). The increase in Tm due to the presence of silk molecules indicates that silk provided structural stability to viral proteins, protecting them from thermal denaturation. The interaction between the viral particles and the hydrophobic regions of the silk, as well as the limited chain mobility, can prevent the aggregation of the viral protein (figure 22B), thus preserving the vaccine's viral infectivity.
The unfolding of a protein is usually associated with an increase in hydrodynamic size as the states of the partially or fully unfolded proteins are unstable and form aggregates (Roberts, 2007). The light scattering results indicate that the naked viral particles aggregated at a much lower temperature than a solution of viral particles on silk. The start of aggregation of the particles as verified by DLS occurs around the same temperature as the protein unfolded, as shown by DSC, indicating that the protein unfolding resulted directly in the aggregation.
The DLS results corroborate the DSC results that silk provides structural stability to viral particles, specifically for viral surface glycoproteins, preventing intermolecular collisions and thus minimizing aggregation at elevated temperatures.
Moisture can also have a significant effect on vaccine products, as excess water introduced into the system can lead to an increase in the corresponding mobility and reactivity of viral proteins (Waterman and Adami, 2005). The analysis of the residual moisture of the films reveals that during the course of the stability test the increase in residual moisture, specifically in the high temperature ranges, is more likely due to the lack of controlled humidity environment provided by the Eppendorf tubes.
While powder MMR and lyophilized dry film MMR were stored in conditions of low humidity, since they are extremely hygroscopic, provided by freeze-drying and stopper bottles, and sealed in a nitrogen-rich environment, MMR in films of silk was stored in Eppendorf tubes, which would allow greater chances for the absorption of atmospheric moisture in the containers than vacuum flasks. The increase in water activity in Eppendorf tubes is also due to the amount of initial water associated with silk films, which is already higher than both the powder and lyophilized films, and the relative humidity of the initial packaging. The increase in residual moisture exhibited in silk films, at high temperatures, could also be explained by the possible desorption of water from silk, which although allowed to dry in the air still contains small amounts of water molecules bound intermolecularly in silk matrices ( Hu et al., 2007). In addition, for silk films stored at room temperature, the atmospheric humidity variability dictated by weather patterns would affect the relative humidity inside Eppendorf tubes.
Although the effect of residual moisture on the vaccine was taken into account, silk films were stored in Eppendorf tubes simply to show that, under minimal processing conditions and without considering special storage, vaccines trapped in silk films are capable of exhibit increased stability at elevated temperatures compared to commercially available lyophilized vaccines tested at the same temperatures. The increased mobility due to humidity and temperature could explain how lyophilized silk films would exhibit such dramatic increases in the stability of normal silk films. The lyophilization and low humidity storage of lyophilized films significantly limits the mobility of viral proteins at high temperatures, making the viral proteins resistant to thermally induced unfolding and associated aggregation. Even though the absolute residual moisture of silk films is higher than that of powder MMR, the percentage of increase in residual moisture in the powder over the tested temperature range is greater than that observed in silk films. The increase in temperature appears to have had a greater impact on temperature-induced moisture in the powder than silk films. It would appear that silk provided inhibition of molecular mobility during storage to prevent protein aggregation and subsequent unfolding, considering that water activity increased in the powder resulting from temperature-induced moisture, without conformational stability provided by silk, increasing the protein aggregation.
Release studies were performed on a variety of vaccine delivery vehicles trapped in silk to show that silk was able to stabilize the vaccine release and control kinetics. Vaccine-loaded silk films and lyophilized silk films
188: were untreated and soluble in water.
They have the potential to be molded into release formats, such as microneedles, a safe and pain-free alternative for the distribution of transdermal medication in hypodermic needles (Tsioris et al., 2011). It is conceivable that a plaster could be applied to the skin and the silk microneedles loaded with vaccine would be punched into the skin, the silk needles dissolving and releasing the vaccine subcutaneously.
The release profile of the silk films shows the promise towards that goal.
Release studies for silk films and lyophilized silk films were conducted in a gelatinous hydrogel, due to a similar consistency to that of the fabric (Wightmas et al., 2007). The silk films melt between 4% and 8% of the similar release profiles displayed for silk (figure 20A-20B), showing an initial burst of release followed by a decrease in the release rate.
The 4% silk film exhibited faster release due to the lower concentration of silk protein, allowing the vaccine to diffuse more rapidly from the matrix, while allowing the film to dissolve more quickly.
As the silk concentration increased to 8%, the release rate decreases due to the increase in the B-leaf content of the film, forming a more rigid matrix and delaying the diffusion of the vaccine in the hydrogel.
The release profiles of the lyophilized silk films showed a more pronounced bursting effect.
As the vaccine diffuses rapidly from silk upon initial contact with the hydrogel, the initial burst of lyophilized films was more likely due to the rapid dissolution of lyophilized films.
For the same reason, like silk films, 4% lyophilized silk films exhibited a faster release profile than 8%. Although the release time scale of the silk film was on the order of hours, 96.85% of encapsulated MM were released by
90 minutes.
Silk vaccine delivery vehicles have also been manufactured in insoluble formats from silk hydrogels and microspheres.
These forms could be incorporated into the release of the injectable vaccine that forms a subcutaneous vaccine deposit capable of releasing the vaccine for an extended period of time.
The hydrogels and microspheres released the vaccine over a period of days.
The slower drug release can be explained by the diffusion of the vaccine, limited by the increased content of B-leaf and microspheres.
Also, as the concentration of hydrogels and microspheres was increased, the linearity of the release improved, corresponding to a decrease in the rate of release. The increase in the silk concentration of the hydrogels resulted in a decrease in the rate of vaccine release. The increase in the silk concentration of the MMR microspheres in silk, however, reduced the release rate and the release rates became more linear, approaching zero order. The microspheres at 8% had a regression coefficient (R2) of 0.95 and 16% of the silk showed a value of 0.988. The increased linearity of the vaccine release from microspheres may be due to the small volumes that generate a lower diffusion gradient for the vaccine particles to cross the volume phase.
These results indicate that these vaccine systems trapped in silk can be manufactured to provide thermal stability for vaccines at elevated temperatures, while functioning as a controlled and sustained release system for the vaccine. the trapping of the MMR vaccine in lyophilized silk films showed greater stability at elevated temperatures outside the recommended cooling chain for a period of time well beyond the manufacturer's vaccines. The choice of silk as an encapsulating polymer also supports the safety of the vaccine security system in implantable or injectable silk, since silk is a biocompatible, biodegradable and FDA approved biomaterial.
(Altman et al., 2003; Horan et al., 2005). The vaccine encapsulated in the silk film and lyophilized silk film provided a highly effective vehicle for the long-term thermostabilization of measles, mumps and rubella.
Both silk film systems were able to increase the half-life of all three viral components of the vaccine compared to the manufacturer's vaccines delivered at 25ºC, 37ºC and 45ºC.
Silk reduces the temperature-induced viral protein unfolding and subsequent aggregation by reducing the residual moisture of the samples during storage at elevated temperatures and also providing structural stability for the vaccine to raise the temperature at which the viral proteins denature.
In addition, silk conveyors can be manufactured in different delivery vehicles capable of adapting the vaccine release kinetics.
This silk support system provides a new vaccine delivery system easily manufactured without special processing considerations, capable of maintaining the vaccine's potency without the need for strict adherence to the cooling chain.
Example 3 Methods Trivalent vaccine.
For the estimation of potency, a commercial source of the MMRº II trivalent vaccine for measles, mumps, rubella (Merck & Co., Inc., USA), a live, attenuated, lyophilized, sterile virus vaccine containing measles type Enders' Edmonston attenuated, mumps type Jery Lynn and rubella Wistar RA 27/3. Before use, the vaccine is reconstituted in diluent and each 0.5 mL dose contained not less than 1,000 TCIDso (infectious tissue culture dose) of the measles virus; 12,500 TCIDsº of the mumps virus and 1,000 TCIDsº of the rubella virus. The manufacturer's conditions indicate that the vaccine must be used within 8 hours after reconstitution and stored at 4ºC or otherwise be discarded. Each 0.5 mL dose contains sorbitol (14.5 mg), sodium phosphate, sucrose (1.9 mg), sodium chloride, hydrolyzed gelatin (14.5 mg), recombinant human albumin (<0.3 mg ), fetal bovine serum (<11 ppm), other buffer and ingredients in the medium and about 25 pg of neomycin.
Purification of fibroin from silk. Aqueous solutions of silk fibroin were prepared as described previously (Wang et al., 2008). B. mori silkworm cocoons were boiled for 30 minutes in an aqueous solution of 0.02 M NaxCO; and then thoroughly rinsed with deionized water to extract sericin. After drying, the silk was dissolved in a 9.3 M LiBr solution for 4 to 6 hours and then dialyzed in water [Distilled using Slide-a-Lyzer dialysis cassettes (MWCO
3,500, Pierce) for 48 hours. The solution was centrifuged to remove aggregates of silk and other insoluble residues. The final concentration of silk fibroin was approximately 9% (weight / volume). The solutions were then subjected to autoclaving during sterility. Purification of the virus. Lyophilized powder vaccine was reconstituted in sterile water and loaded into 0.5 kDa dialysis tubes (Sigma Aldrich), and dialyzed against a 0.15 M NaCl solution to remove excipients from the vaccine solution. The recovered vaccine solution was then operated through a desalination column PD-110 (GE Healthcare), to remove excess salt. The rotation protocol was followed by the manufacturer's specifications. The purified and recovered viral particle solution was collected and stored in an Eppendorf tube at -80ºC until use. 'Vaccine encapsulated in silk films. The process for making the vaccine encapsulated in silk film is illustrated in figure 7. A mixture of a sterile 9% silk solution (weight / volume) and the bone MMR vaccine | was prepared at a concentration of 1: 1 by weight of MMR for silk solution. The films were then molded onto the Teflon-coated surface. The films were dried) im | al a sterile chamber for 12 hours at room temperature, protected from light. Individual films were placed in Eppendorf tubes under ambient conditions and stored at 4ºC, 25ºC, 37ºC and 45ºC for stability studies.
Lyophilization of the silk films that encapsulate vaccine. Silk solutions containing MMR (1: 1 weight ratio) were aliquoted into 96-well plates and lyophilized using a VirTis 25K Genesis 251 SQ Super XL-70 freeze dryer. The samples were frozen at -45ºC for 480 minutes. Primary drying took place at -20ºC for 2,400 minutes and secondary drying at 35ºC for 620 minutes. The samples were kept at -45ºC until they were removed from the freeze dryer. The films were then removed from the well plates and transferred to 5 cmº glass vials of serum. 5 mm freeze-drying stoppers were applied to the flasks in a nitrogen atmosphere and under vacuum conditions, in an MBRAUN LABmaster glove box (Garching, Germany) and a 5 mm clamp was used to tighten the 5 mm aluminum seal on the bottles. The bottles were stored at 4ºC, 25ºC, 37ºC and 45ºC for stability studies. The bottles, stoppers, seals and clamps were supplied by VWR (Bridgeport, NJ). ; Vaccine encapsulated in silk hydrogels. The silk solution was "to concentrations of 2-5% by weight and then | | autoclaved to provide sterility. Then 1 mL of the silk solution was transferred to a 2 mL autoclaved Fisher glass bottle , and the solution was mixed in the glass vial for 7 minutes at 3,200 rpm using a Fisher shaker. The cloudy solution was collected and transferred to 2 ml Eppendorf tubes, the vaccine was gently mixed into the solution with a 1: 1 ratio in The silk vaccine solution was incubated in the Eppendorf tube at room temperature until gelation. The gels were then refrigerated during long-term storage. Vaccine encapsulation in silk microspheres. The production of vaccine loaded microspheres of the combinations silk / PVA used the procedure described by gor Wang et al (2010). Powder vaccine was added to des
A 5 wt% silk solution to achieve a 1: 1,000 weight ratio. This solution was mixed gently with a “master solution of 5% PVA (weight / volume) (polyvinyl color, molecular weight 30,000-70,000, Sigma Aldric). Using a consistent weight ratio of 1: 4, a 5% (weight / volume) silk-PVA solution was prepared by mixing 1 ml of the 5% silk weight solution with 4 ml of he PVA solution to 5% by weight. The silk solution was mixed and autoclaved to obtain sterilization. After mixing, the solution was stirred for 2 hours at room temperature.
| . GO
Then, the 5% solution (weight / volume) was transferred to a 35 mm Petri dish. The solution was dried overnight in a laboratory chapel. The dry films were dissolved in 30 ml of ultrapure water with 10 minutes of gentle stirring at room temperature and then centrifuged at 16,000 rpm for 20 minutes at 4ºC. The supernatant was discarded and the pellet resuspended in 30 ml of ultrapure water was centrifuged again. The final pellet was suspended in 2 mL of ultrapure water.
Quantitative infectivity test in real time RT-PCR. A standard curve was generated by serial dilution of a solution of the only vaccine reconstituted in sterile water. The reconstituted vaccine, considered as the 1 logi dilution, was serially diluted in steps of 0.5 just from 1.5 logiwW and 3.5 logiw. MMR films on silk (containing a 1 log dilution of the vaccine) were redissolved in an aliquot of water and the solution was added directly to the cells in culture. Vero cells (African green monkey kidney cells) (ATCC, Manassas, VA) were grown in M199 medium with 25 mM HEPES 25 and L-glutamine (Sigma-Aldrich, St. Louis, MO), 1% | penicillin / streptomycin (Invitrogen Life Technologies, Carlsbad, USA) and fetal bovine serum a (Invitrogen). The cells were treated with it | i | |
DU: ul counted and adjusted to 50 thousand cells / mL and placed in 24-well plates. Then, 50 µl of the vaccine dilution and redissolved silk film were added to a well of Vero cells, in triplicate. The virus was allowed to replicate in the cells for 3 days, then the RNA from the infected cells was isolated, converted to DNAC and quantified using qPCR. There is a log-linear relationship between the amount of target RNA and the PCR cycle in which fluorescence rises above the bottom (limit cycle, Ct). The more viable the viruses present in the sample, the less cycles and the faster the fluorescence of the PCR product will be needed for the background above and, therefore, the lower the Ct value. In order to account for variable cell growth, each time an assay is performed, a standard curve is generated for serial dilution of a vaccine solution containing the same amount of vaccine loaded into the NMR on the silk films. Viral infectivity was measured shortly after the preparation of the initial film to establish baseline activity (time 0). The measurements in -.
Subsequent time periods were compared with the value of tengo O to establish the residual power. The starting power 1). recovered from silk films, vid activity | immediately after the fusion of the film, it was determined by comparing the viral infectivity measured by sharing the t In dE |! was going
198! silk films in relation to the infectivity of a vaccine solution alone, containing the same concentration of vaccine as loaded on silk films. The residual power of the MMR
In silk films it was calculated by viral infectivity Es measured at the right point of time compared to the initial potency recovered and the residual potency of the powder vaccine in storage was measured by comparing viral activity compared to the infectivity of the vagina | used to determine the initial potency recovered from the silk films. As controls, viral activities were also measured for the silk films of loaded vaccines. W | RNA was isolated from Vero cells using the TRIZol reagent (Invitrogen) and chloroform. The RNA was pusigitlao using the Qiagen RNEasy kit (Qiagen, Valencia, Reverse transcription was performed on purified RNA to synthesize DNAC, using the Transcription Kit —— High Capacity DNAC (Applied Biosystems, Foster City, CA). RT- Real-time PCR was performed on an Mx30 system of the Stratagene dl) QPCR (Stratagene, La Jolla, CA). The reaction and ions were carried out in 50 µl MIX volumes containing Tad! a Universal PCR Matter MIS (IX) (Applied Biosystems, Fost tr City, CA), 0.9 µM of each of the PCR primers and the 25 ypM of the probe with 5 1pL of the DNAC sample. For the section)> am | | | UN
] 199 Measles, a 114 bp fragment (nt 584-697) was amplified with the forward primer (5'-CCCTGAGGGATTCAACATGATTCT-3 '), reverse primer (5'- ATCCACCTTCTTAGCTCCGAATC-3') and and probe (5 'FAM- TCTTGCTCGC AAAGGCGGTTACGG-BHQ1 3 ') (Hobschen) et al., 2008). For rubella detection, direct primer (5! -TGATACCC AGACCTGTGTTCAC-3 '), reverse primer 6 GGTCGATGAGG ACGTGTAGG-3') and a probe (5 'JOE-GATCACCCAGCACTCCACGCAA BHQ-l 3') were used to amplify a region of 129 bp (nt 195-323) (Htbschen et al., 2008). For the detection of a 134 bp region of the mumps virus, direct primer (5! -CATAGGAGATATGTGGG | 3 '), reverse primer (5' -GTCTTCGCCAACGATGGTGATGATTG-3 /) and a probe (5 'JOE-CCATGCAGGGGACACACGGACACACGGACACACGGACACACACGACACACACGACACACACACGACACACACACACGACACACACAT were used (Kubar et al., 2004). All primers,: and probes were obtained from Sigma-Aldrich (St. Louis, MO). The PCR reaction conditions were 2 minutes at 50ºC, h minutes at 95ºC, and then 50 cycles at 95ºC for 15 seconds and 60ºC for 1 minute. | | Release of the vaccine in vitro. In vitro vaccine release studies were carried out at 37ºC. Release studies for silk films & & | lyophilized samples were made in a hydrogel and 1) gelatin model. The gelatin hydrogel was prepared by mixing U of 4.5 gq of flavorless powdered gelatin, original, Knox ",; | | | |
Í E | AND IS
40 ml of boiled deionized water to obtain 0.112 g / ml of hydrogel. The solution was poured into a 35 mm Petri dish and cooled. To start a release study, a film was placed between two slices of the hydrogel. Once a time point was reached, the film was removed from the gel to stop the release. The hydrogels were then digested in 400 nl of 1 mg / ml of collagenase (Sigma Aldrich) for 2 hours at 37 ° C. Subsequently, the MMR released 2 is quantified by the Vera cell infectivity assay. | The in vitro release of hydrogels and silk microspheres was performed in 2 ml Eppendorf tubes. Each hydrogel or microsphere solution was placed in an eopencos tube with the addition of 1.5 mL of sterile PBS. At each point in time, the PBS inside the Eppendorf tube was removed | and
TE transferred to another Eppendorf tube and stored at -80 ° C fresh PBS was then added to the tubes to replenish the supply. Once all samples were collected at the defined time points, the solutions were tested using the Vero cell infectivity assay to quantify the amount of MMR released. Ide release values have been reported as cumulative released MMR. | | Determination of residual moisture. The residual moisture | of the vaccine freeze-dried powder vaccine, MMR in silk films and MMR in lyophilized silk films was measured De im | : see the 201 thermo-gravimetric method, modified from Worrall et al., 2001, which allows estimating the average weight of three samples from each vaccine system after drying for one hour at 80ºC.
The weight of water lost from the dry vaccine system is expressed as a percentage. | Differential scanning calorimetry (DSC). 5 mg samples were encapsulated in aluminum containers and heated in a TA Q100 DSC Instrument (New Castle, DE), with a flow of dry purged nitrogen gas of 50 mL / minutes.
Tg was recorded as the initial temperature of the heating flow discontinuity versus temperature curve.
All measurements were made at 10ºC / minutes.
The samples were initially equilibrated at -20ºC for 5 minutes and then heated to 200ºC, maintained at 200ºC for 5 minutes, followed by cooling to 20ºC.
Nano-DSC measurements were performed on a CSD 6100 Nano II Model of Differential Scanning Calorimetry (Lindon, UT). The samples were prepared at a concentration of 1 mg / mL.
The scan rate was fixed at 1ºC / minute for both heating and cooling operations from 0 to 100ºC.
Dynamic light scattering (DLS). The size of the measles, mumps and rubella virus particles as a function of temperature was monitored by DLS.
A 400 µl aliquot of 2 mg / mL of the sample solution was mg / mL. Sample solution was filtered through a 0.45 µm syringe filter (GE, Fairfield, CT). DLS was conducted using the DLS DynaPro system (Wyatt Technology, Santa Barbara, CA) with the parameters set in acquisition time of 60 seconds, acquisition number 10 and laser energy of 75 mW.
A 100 pl aliquot of the sample was transferred to a protein-free Eppendorf UVette cuvette, free of DNAsSEe, free of RNAse to be inserted into the DLS.
The effective hydrodynamic diameter was calculated from the diffusion coefficient, using the Stokes-Einstein equation using the cumulative method (Koppel, 1972). Example 3. References Adu, F.D., Adedeji, A.A., Esan, J.S. and Odusanya, O.G. (1996). Live viral vaccine potency: an index for assessing the cold chain system.
Public Health. 110: 325-330. Altman, G.H., Diaz, F., Jukuba, C., Calabro, T., Horan, R.L., Chen, J., Richmond, J., and Kaplan, D.L. (2003). Silk-based biomaterials.
Biomaterials. 24: 401-416. Arora, A., Prausnitz, M. and Mitragotri, S. (2008). Micro-scale devices for transdermal drug delivery.
International Journal of Pharmaceutics. 364: 227-236. Arya, S.C. (2001). Stabilization of vaccines: to be or not to be.
Vaccine. 19: 595-597. Ausar, S.F., Hudson, T.R., Hudson, M.H., Vedvick, T.S.
and Middaugh, C.R. (2006). Conformational stability and disassembly of Norwalk virus like particles: effect of pH and temperature. Journal of Biological Chemistry. 281: 19478-19488.
Beauchamp, J. and Mansoor, O. (1992). Temperature and the storage of vaccines. New Zealand Medical Journal. 105:
135.
Bishai, D.M. (1992). Vaccine storage practices in pediatric offices. Pediatrics. 89: 193-196.
Brandau, D.T., Jones, L.S., Wiethoff, C.M., Rexroad, J. and Middaugh, C.R. (2003). Minireview: Thermal Stability of Vaccines. Journal of Pharmaceutical Sciences. 92 (2): 218-
231.
Chen, D. and Kristensen, D. (2009). Opportunities and challenges of developing thermostable vaccines. Expert Review of Vaccines. 8.5: 547-558.
Cheriyan, E. (1993). Monitoring the vaccine cold chain. Archives of disease in childhood. 69: 600-601.
Cheyne, J. (1989). Vaccine delivery management. Reviews of infectious diseases. 11: S617-S622.
Colinet G., Rossignol, J. and Peetermans, J. (1982). A study of the stability of a bivalent measles-mumps vaccine. Journal of biological standardization. 10: 341-346.
Creighton, T.E. (nineteen ninety). Protein folding. Biochemical
Journal. 270: 1-16.
Dorsett, P.H., Miller, D.C., Green, K.Y. and Byrd, F.I. (1985). Structure and function of the rubella virus proteins. Reviews of Infectious Diseases. 7 (1): S150-S156.
Evans, M. and Pope, M. (1995). Vaccine handling and storage in general practice. Health Trends. 27: 124-126.
Galazka, A., Milstien, J., and Zaffran, M. (1998). Thermostability of Vaccines. In: Global Program for Vaccines and Immunization. World Health Organization, Geneva.
Hall, W.W. and Martin, S.J7. (1973). Purification and Characterization of Measles Virus. Journal of General Virology. 19: 175-188.
Health Protection Agency. (2007). Foreign travel associated illness, England, Wales, and Northern Ireland. 2007 Report. [online]. Accessed at hpa.org.uk/Publications/InfectiousDiseases/TravelHealth/070 8Foreigntravelassociatedillness2007 /. .
Hofmann, S., Wong Po Foo, C.T., Rossetti, F., Textor, M., Vunjak-Novakovic, G., Kaplan, D.L., Merkle, H.P. and Meinel I. (2006). Silk fibroin as an organic polymer for controlled drug delivery. Journal of Controlled Release. 111: 219-227.
Horan, R.I., Antle, K., Collette, A.I., Wang, Y., Huang,
J. and Moreau, J.E .. In vitro degradation of silk fibroin. Biomaterials. 26: 3385-3393.
Hu, X., Kaplan, D.L. and Cebe, P. (2007). Effect of water on the thermal properties of silk fibroin. Thermochimica Acta. 461: 137-144.
Hubschen, J.M., Kremer, J.R., by Landtsheer, S., and Muller, C.P. (2008). A multiplex TaqgMan PCR assay for the detection of measles and rubella virus. Journal of Virological Methods. 149: 246-250.
Jin, H.J. and Kaplan, D.L. (2003). Mechanism of silk processing in insects and spiders. Nature. 424: 1057-1061.
Kingston, R.L., Gay, L.S., Baase, W.S. and Matthews, B.W. (2008). Structure of the nucleocapsid-binding domain fron the mumps virus polymerase; An example of protein folding induced by crystallization. Journal of Molecular Biology. 379 (4): 719-731.
Kissman, J., Ausar, S.F., Rudolph, A., Braun, C., Cape, S.P., Sievers, R.E., Federspiel, J., Joshi, S.B. and Middaugh C.R. (2008). Stabilization of measles virus for vaccine formulation. Human Vaccines. 4 (5): 350-359.
Koppel, D.E. (1972). Analysis of macromolecular polydispersity in intensity correlation spectroscopy: The method of cumulants. Jounral of Chemical Physics. 57 (11): 4814-4820.
Kubar, A., Yapar, M., Besirbellioglu, B., Avci, Y., and Guney, C. (2004). Rapid and quantitative detection of mumps virus RNA by one-step real-time RT-PCR. Diagnostic Microbiology and Infectious Disease. 49: 83-88.
Kumakura, M. (1995). Effect of heat treatment on enzyme entrapped into polymer gels. Journal of Molecular Catalysis B: Enzymatic. Ll1-L6.
Lee, S., Schoneich, C., and Borchardt, R.T. (1994). Chemical instability of protein pharmaceuticals: mechanisms of oxidation and strategies of stabilization. Biotechnology and Bioengineering. 48: 490-500.
Liddle, J.L.M. and Harris, M.F. (1995). How general practitioners store vaccines. A survey in south-western Sydney. The Medical Journal of Australia. 162: 366-368.
Malvoisin, E. and Wild T.F. (1993). Measles virus glycoproteins: studies on the structure and interaction of the haemagglutinin and fusion proteins. Journal of General Virology. 74: 2365-2372.
Manning, M.D. and Borchardt, P.K. (1989). Stability of pharmaceutical proteins. Pharmaceutical Research. 6: 903-918.
McAleer, W.J., Markus, H.Z., McLean, A.A., Buynak, E.B. and Hilleman, M.R. (1980). Stability on storage at various temperatures of live measles, mumps and rubella virus vaccines in new sStabilizer.
Middaugh, C.R. (1996). Formulation and delivery of biopharmaceuticals. Journal of Pharmaceutical Sciences. 85: 1259-1260. Moss, W.J. and Griffin, D.E. (2006). Global measles elimination. Nature Review Microbiology. 4: 900-908.
Nakhasi, H.L., Cao, X., Rouault, T.A. and Liu, T. (1991). Specific binding of host cell proteins to the 3'- terminal stem-loop structure of rubella virus negative- strand RNA. Journal of Virology. 5961-5967.
Ohtake, S., Arakawa, T. and Koyama, A.H. (2010). Arginine as a Synergistic Virucidal Agent. Molecules. 15: 1408-1424.
Packer, L., Colowick, S.P. and Kaplan, N.O. (2002). Methods in enzymology. Ed. Packer, L. Academic Press, California, USA. Volume 349.
Pritchard, E., Szybala, C., Boison, D., and Kaplan, D.L. (2010). Silk fibroin encapsulated powder reservoirs for sustained release of adenosine. Journal of Controlled Release. 144 (2): 159-167.
Rexroad, J., Evans, R.K. and Middaugh, C.R. (2006). Effect of pH and ionic strength on the physical stability of adenovirus type 5. Journal of Pharmaceutical Sciences. 95: 1469, 1479.
Roberts, C.9. (2007). Non-Native Protein Aggregation
Kinetics. Biotechnology and Bioengineering. 98 (5): 927-938. Russell, B., Selzer, G. and Goetze, H. (1967). The Particle size of rubella virus. Journal of General Virology. 1: 305-310.
Schalk, J.A.C., de Vries, C.G.J.C.A, and Jongen, P.M.JI.M. (2005). Potency estimation of measles, mumps and rubella trivalent vaccines with quantitative PCR infectivity assay. Biologicals. 33: 71-79 Tsioris, K., Raja, W.K., Pritchard, E.M., Panilaitis, B., Kaplan, D.L. and Omenetto, F.G. (2011). Fabrication of silk microneedles for controlled-release drug delivery. Advanced Functional Materials. Published online: December 2,
2011.
Vepari, C. and Kaplan, D.L. (2007). Silk as a biomaterial. Progress in Polymer Science. 32 (8-9): 991-
1007.
Wang, X., Yucel, T., Lu, Q., Hu, X. and Kaplan, D.L. (2010). Silk nanospheres and microspheres from silk / pva blend films for drug delivery. Biomaterials. 31: 1025-1035.
Wang, X., Zhang, X, Castellot, J., Herman, I., Iafrati, M. and Kaplan, D.L. (2008). Controlled release from multilayer silk biomaterial coatings to modulate vascular cell responses. Biomaterials. 29: 894-903.
Waterman, Kºand Adami, R.C. (2005). Accelerated aging:
Prediction of chemical stability of pharmaceuticals. International Jounral of Pharmaceutics. 293: 101-125.
Wightman, G., Beard, J. and Allison, R. (2007). An investigation into the behaviors of air rifle pellets in ballistic gel and their interaction with bone. Forensic Science International. 200 (1-3): 41-49.
WHO. (1982). Report of Expert Committee on Biological Standardization. Thirty-second report. Requirement for measles vaccine (live). Addendum 1981, Geneva, World Health Organization. (Technical Report Series no. 673, Annex 6).
WHO. (1994). Report of Expert Committee on Biological Standardization. Requirements for measles, mumps and rubella vaccines and combined vaccines (live). Geneva, World Health Organization. (Technical Report Series, No. 840, Annex 39).
WHO (2006). Temperature sensitivity of vaccines. WHO publications. [Online]. The reference can be accessed at whqglibdoc.who.int/hq/2006/WHO IVB 06.10 eng.pdf WHO. (2011). Measles. Media center fact sheet Nº286. October 2011. [online]. The reference can be accessed at who.int/mediacentre/factsheets/fs286/en/ WHO, UNAIDA, World Bank, UNESCO, UNFPA (2000). Health: a key to prosperity. In: Success Stories in Developing Countries. World Health Organization, Geneva.
Wild, T.F./ ”Malvoisin, E. and Buckland, R. (1991).
. - 210 Measles virus: both the haemagglutinin and fusion glycoproteins are required for fusion.
Journal of General Virology. 72: 439-442. Woelk, C.H., Pybus, O.G., Jin, L., Brown, D.W.G. and Holmes, E.C. (2002). Increased positive selection pressure in persistent (SSPE) versus acute measles virus infections.
Journal of General Virology. 83: 1419-1430. Wolfson, LJ, Gasse, F., Lee-Martin, S., Lydon, P., Magan, A., Tibouti, A., Johns, B., Hutubessy, R., Salama, P. and Okwo-Bele, J. (2008). Estimating the costs of achieving the WHO-UNICEF Global Immunization Vision and Strategy, 2006-2015. Bulletin of the World Health Organization. 86: 27-39. Worrall, E.E., Litamoi, J.K., Seck, B.M. and Ayelet, G. (2001). Xerovac: an ultra rapid method for the dehydration and preservation of live attenuated Rinderpest and Peste des Petits ruminants vaccines.
Vaccine. 19: 834-839. Zhou, D., Porter, W.R. and Zhang, G.G.Z. (2009). Chapter 5 - Drug stability and degradation studies.
Developing Solid Oral Dosage Forms: Pharmaceutical Theory and Practice.
Ed: Qiu, Y., Chen, Y., Zhang, G.G.Z., Liu, L. and Porter, W.R.
Pg: 87-124. Zweig, S.E. (2006). Advances in vaccine stability monitoring technelogy.
Vaccine. 24: 5977-5985.

权利要求:
Claims (41)
[1]
1. Storage-stable composition comprising a matrix of silk fibroin and an active agent distributed therein, characterized by the fact that the active agent is an immunogen selected from the group that consists of a live attenuated virus; an inactivated virus; a viral subunit; a viral vector; a live attenuated bacterium; a dead bacterium; an inactivated bacterium; a bacterial subunit; and a pathogen inactivated toxin; and the active agent retains at least about 30% of its original bioactivity when the composition is (a) subjected to at least one freeze-thaw cycle, or (b) maintained for at least about 24 hours at a temperature above 0ºC, or (c) both (a) and (b).
[2]
2. Composition according to claim 41, characterized by the fact that the silk fibroin matrix is a solution.
[3]
3. Composition according to claim 1 or 2, characterized by the fact that the silk fibroin matrix is in a solid shape state.
[4]
Composition according to claim 3, characterized in that the solid state is a film, a fiber, a particle, a gel, a hydrogel or a composition thereof.
[5]
Composition according to either of Claims 1 and 4, characterized in that the composition is lyophilized.
[6]
6. Composition according to any one of claims 1, 4 and 5, characterized by the fact that the composition is micronized.
[7]
Composition according to claim 6 & characterized by the fact that the micronized composition comprises nanoparticles or microparticles.
[8]
8. Composition according to claim 7, characterized by the fact that nanoparticles or microparticles have a size of about 10 nm to about
1,000 um.
[9]
Composition according to any one of claims 1 and 4 to 8, characterized in that it additionally comprises an additive distributed through the silk fibroin matrix.
[10]
10. Composition according to claim 59, characterized in that the additive is selected from a stabilizing agent, a pharmaceutically acceptable carrier, or any combination thereof.
[11]
11. Composition according to claim 1, characterized by the fact that the immunogen is derived from the hepatitis B virus, Haemophilus influenzae type B, poliovirus, Neisseria meningitidis C, Influenza, Varicella, Mycobacteria tuberculosis or Calmette-Guérin bacillus, tetanus toxoid, diphtheria toxoid and Bordetella pertussis.
[12]
12. Composition according to claim 1, characterized by the fact that the immunogen is a combination of immunogens selected from the group consisting of DTaP, DTwP, DTwWP hepB, DTP hep B Hib, DTdaP Hep B Hib IPV and any combinations thereof .
[13]
13. Composition according to claim 1, characterized by the fact that the immunogen is a live, attenuated virus.
[14]
14. Composition according to claim 13, characterized by the fact that the live, attenuated virus is an enveloped virus.
[15]
15. Composition, according to claim 14, characterized by the fact that the enveloped virus is selected from the group consisting of Paramyxoviridae, Togaviridae, Orthomyxoviridae, Flaviviridae, Herpesviridae, Rhabdovirus, Retroviridae and any combinations thereof.
[16]
16. Composition according to any one of claims 13 to 15, characterized by the fact that the virus is chickenpox.
[17]
17. Composition according to any one of claims 13 to 15, characterized by the fact that the virus is influenza.
[18]
18. Composition according to claim 13, characterized by the fact that the live, attenuated virus causes measles, mumps or rubella.
[19]
19. Composition, according to claim 1, characterized by the fact that the immunogen is a live, attenuated, non-enveloped virus.
[20]
20. Composition according to claim 19, characterized by the fact that the non-enveloped virus is rotavirus, reovirus, hepatitis virus, rabies virus or poliovirus.
[21]
21. Composition according to claim 1, characterized by the fact that the immunogen is a live, attenuated bacterium; a dead bacterium; or an inactivated bacterium.
[22]
22. Composition according to claim 21, characterized by the fact that the bacterium is Mycobcteria tuberculosis, Calmette-Guérin bacillus or Bordetella pertussis.
[23]
23. Composition according to claim 1, characterized by the fact that the immunogen is a bacterial subunit.
[24]
24. Composition according to claim 23, 5 characterized by the fact that the bacterial subunit is derived from Neisseria meningitidis type C, Haemophilus influenzae type B, Streptococcus pneumoniae, or group B streptococcus.
[25]
25. Composition according to claim 23, characterized by the fact that the subunit is a bacterial polysaccharide.
[26]
26. Composition according to claim 1, characterized by the fact that the immunogen is a viral subunit.
[27]
27. Composition according to claim 26, characterized by the fact that the viral subunit is derived from the hepatitis B virus or human papillomavirus.
[28]
28. Composition according to claim 1, characterized by the fact that the immunogen is recombinant.
[29]
29. Composition according to claim 1, characterized by the fact that the immunogen is a vaccine product selected from the group consisting of anthrax vaccine (BioThrax); BCG (Bacillus of Calmette-Guérin) (Tice, Mycobax); DTaP (Daptacel); DTaP (Infanrix); DTaP (Tripedia);
DTaP / Hib (TrYiHIBit); DTaP-IPV (Kinrix); DTaP-HepB-IPV (Pediarix); DTaP-IPV / Hib (Pentacel), DT (diphtheria vaccine plus tetanus vaccine) (Sanofi), Hib vaccine (ACTHib); DT (Massachusetts), Hib vaccine (PedvaxHIB); Hib / Hep B (Comvax); Hep A (Havrix), Hepatitis A vaccine, hep A (vagta), Hepatitis A vaccine, hep B (Engerix-B), hepatitis B vaccine, Hep B (Recombivax), hepatitis B vaccine; vaccine against HepA / HepB (Twinrix); Human Papillomavirus (HPV) (Gardasil); influenza vaccine (Afluria); influenza vaccine (Fluarix); Influenza vaccine (FluLaval); influenza vaccine (Fluvirin); Influenza vaccine (Fluzone); influenza vaccine (FluMist); IPV (Ipol), polio vaccine, Japanese encephalitis vaccine (JE-Vax); Japanese encephalitis vaccine (Ixiaro); meningococcal vaccine (Menactra); triple viral vaccine (MMR-II); MMRV vaccine (ProQuad); pneumococcal vaccine (Pneumovax); pneumococcal vaccine (Prevenar); inactivated poliovirus (Poliovax), polio vaccine; anti-rabies vaccine (Imovax); rabies vaccine (RabAvert); rotavirus vaccine (RotaTegq); rotavirus vaccine (Rotarix), Td vaccine (Decavac); Td vaccine (Massachusetts); DTaP vaccine (Adacel); DTaP vaccine (Boostrix); typhoid (inactivated-Typhim Vi), vaccine against typhus; Typhoid (oral - Ty21a), vaccine against typhus; Vaccinia (ACAM2000), vaccine against chickenpox (Varivax); yellow fever vaccine (YF-Vax); Zoster vaccine (Zostavax) and any combinations.
[30]
30. Method for preparing a storage-stable composition according to any one of claims 1, 4 to 10, 11 to 29, 36, 37 and 38, The method characterized by the fact that it comprises the steps of: a. providing a silk fibroin solution comprising at least one active agent, and b. drying the silk fibroin solution from step (a) to form a solid silk fibroin, thus obtaining a composition in which the at least one active agent retains at least about 30% of its initial bioactivity after storage.
[31]
31. Method according to claim 31, characterized in that it additionally comprises the lyophilization of silk fibroin in solid state from step (b).
[32]
32. Method according to claim 30 or 31, characterized in that it additionally comprises post-treatment of the composition.
[33]
33. Method according to claim 32, characterized in that the post-treatment alters the crystallinity of the composition.
[34]
34. Method, according to claim 32 or 33, characterized by the fact that the post-treatment constitutes contact with the composition with methanol or ethanol, subjecting the composition to shear, subjecting the composition to the electric field, subjecting the composition to pressure, or by contacting the composition with salt.
[35]
35. Method according to claims 30, 31, 32, 33 or 34, characterized by the fact that it additionally comprises the reduction of silk fibroin in the solid state of step (b) by a mechanical device for obtaining particles micronized.
[36]
36. Composition according to claim 10, characterized in that the stabilizing agent is selected from the group consisting of a saccharide, a sugar alcohol, an ion, a surfactant, and any combinations thereof.
[37]
37. Composition according to claim 36, characterized by the fact that saccharide is sucrose.
[38]
38. Composition according to claim 1, characterized by the fact that the live attenuated virus or inactivated virus is an enveloped virus selected from the group consisting of chickenpox, measles virus, mumps virus, German measles virus, syncytial virus respiratory system, yellow fever virus, and the flu virus.
[39]
39. Method for stabilizing an immunogen characterized by the fact that it comprises mixing an immunogen and a solution of silk fibroin, in which the immunogen is selected from the group consisting of a live, attenuated virus; an inactivated virus; a viral subunit; a viral vector; a live, attenuated bacterium; a dead bacterium; an inactivated bacterium; a bacterial subunit; and a toxin inactivated from a pathogen.
[40]
40. Method according to claim 39, characterized in that it further comprises a solid form state from the silk fibroin solution.
[41]
41. Method according to claim 40, characterized in that the solid state consists of a film, a fiber, a hydrogel, a skeleton, a tangle, a particle, a lyophilized matrix, a needle, and a composition.
Summary of the Patent for: “COMPOSITIONS AND METHODS FOR STABILIZATION OF ACTIVE AGENTS” This document provides methods and compositions for stabilizing active agents.
The active agents are distributed, mixed or encapsulated in a silk fibroin matrix, thereby retaining the bioactivity of the active agents during storage and / or transportation.
In some embodiments, storage stable silk vaccine compositions are also provided herein.
This annex presents the control code for the listing of biological sequences dealt with in INPI Resolution 228 of 11/11/2009: Control Code Field 1; DONATE Year "Field 2
INI Other Information: - File Name: SEQUENCE LISTING. txt - Code Generation Date: 12/20/2013 - Code Generation Time: 13:38:14 - Control Code: - Field 1: 109A3DB8D53183BB - Field 2: 2D888CE59ED39501 Generated by the Biological Sequence Listing System (SisBioList ) :: Version 2.1.0

类似技术:

---

公开号 | 公开日 | 专利标题

---

AU2018226377B2|2020-09-03|Compositions and methods for stabilization of active agents

---

JP2020089384A|2020-06-11|Prefusion rsv f proteins and their use

---

US20210290829A1|2021-09-23|Silk fibroin-based microneedles and methods of making the same

---

JP2008526870A|2008-07-24|Delivery vehicles, bioactive substances and viral vaccines

---

CN103096922B|2019-08-06|For treating the composition and method of influenza

---

Nguyen et al.2019|Skin immunization with third-generation hepatitis B surface antigen using microneedles

---

CN107406856A|2017-11-28|Hand, foot and mouth vaccine and its method of preparation and use

---

CN108743938B|2019-04-09|For enhancing the preparation method of the compound of immune response

---

US9782475B2|2017-10-10|Method of treating food allergies by administering a nanoparticle comprising heparin and chitosan encapsulating IL-12

---

JPWO2017122635A1|2018-11-08|Vaccine containing immobilized virus particles

---

CN109078180B|2019-05-31|For enhancing the compound of immune response

---

Ross et al.2014|Vaccine technologies against avian influenza: current approaches and new directions

---

Stinson et al.2021|Enhancing influenza vaccine immunogenicity and efficacy through infection mimicry using silk microneedles

---

BR112020001768A2|2020-09-29|method of reinforcing a pre-existing immune response against haemophilus influenzae and moraxella catarrhalis not typeable in an individual, and, vaccination protocol.

---

Haughney2015|Polyanhydride nanovaccine platform against bacterial pathogens

---

Bajrovic2020|Development and characterization of thermostable thin films as a novel vaccine dosage form

---

Ross2013|Synthetic nanoparticle-based vaccines against respiratory pathogens

同族专利:

---

公开号 | 公开日

---

AU2012245198A1|2013-11-07|

---

EP2699266A4|2014-12-24|

---

CA2833879A1|2012-10-26|

---

US20180360947A1|2018-12-20|

---

US20140287043A1|2014-09-25|

---

AU2012245198B2|2017-07-13|

---

AU2020217419A1|2020-09-17|

---

AU2020203212A1|2020-06-11|

---

IL228984D0|2013-12-31|

---

CN103796683A|2014-05-14|

---

AU2017204162A1|2017-07-27|

---

WO2012145739A1|2012-10-26|

---

JP2017137328A|2017-08-10|

---

EP2699266B1|2019-06-12|

---

US20170258889A1|2017-09-14|

---

AU2018226377A1|2018-09-27|

---

EP2699266A1|2014-02-26|

---

JP2014518557A|2014-07-31|

---

CN105148285A|2015-12-16|

---

JP6170906B2|2017-07-26|

---

CN105148285B|2019-02-12|

---

AU2018226377B2|2020-09-03|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US8808A|1852-03-16|Planiwg-machiete |

---

US3854480A|1969-04-01|1974-12-17|Alza Corp|Drug-delivery system|

---

US3832253A|1973-03-21|1974-08-27|Baxter Laboratories Inc|Method of making an inflatable balloon catheter|

---

US4675189A|1980-11-18|1987-06-23|Syntex Inc.|Microencapsulation of water soluble active polypeptides|

---

US4452775A|1982-12-03|1984-06-05|Syntex Inc.|Cholesterol matrix delivery system for sustained release of macromolecules|

---

US4667014A|1983-03-07|1987-05-19|Syntex Inc.|Nonapeptide and decapeptide analogs of LHRH, useful as LHRH antagonists|

---

CA1200416A|1983-05-13|1986-02-11|Societe Des Produits Nestle S.A.|Food process|

---

JPH0652268B2|1985-07-03|1994-07-06|鐘紡株式会社|Immobilized antigen|

---

CN86100565A|1986-04-30|1987-11-11|华东化工学院|A kind of covalent activated fixed enzyme vector|

---

JPH07121871B2|1986-10-09|1995-12-25|国立予防衛生研究所長|Influenza vaccine freeze-dried preparation|

---

US5075109A|1986-10-24|1991-12-24|Southern Research Institute|Method of potentiating an immune response|

---

IE61575B1|1987-05-04|1994-11-16|Merck & Co Inc|A stable lyophilized live herpes virus vaccine|

---

US5133974A|1989-05-05|1992-07-28|Kv Pharmaceutical Company|Extended release pharmaceutical formulations|

---

JP2750306B2|1989-05-24|1998-05-13|ポーラ化成工業株式会社|Method for producing immobilized low molecular protein A|

---

DE3920358A1|1989-06-22|1991-01-17|Behringwerke Ag|BISPECIFIC AND OLIGO-SPECIFIC, MONO- AND OLIGOVALENT ANTI-BODY CONSTRUCTS, THEIR PRODUCTION AND USE|

---

US5245012A|1990-04-19|1993-09-14|The United States Of America As Represented By The Secretary Of The Army|Method to achieve solubilization of spider silk proteins|

---

JPH04167172A|1990-10-31|1992-06-15|Nec Corp|Vector processor|

---

EP0617706B1|1991-11-25|2001-10-17|Enzon, Inc.|Multivalent antigen-binding proteins|

---

US5407686A|1991-11-27|1995-04-18|Sidmak Laboratories, Inc.|Sustained release composition for oral administration of active ingredient|

---

US5346481A|1993-10-14|1994-09-13|Merck & Co., Inc.|Vaccine delivery system|

---

US5900238A|1995-07-27|1999-05-04|Immunex Corporation|Vaccine delivery system|

---

JPH11511325A|1995-08-22|1999-10-05|アグリコラ・テクノロジーズ・インコーポレイテツド|Cloning method of high strength spider silk protein|

---

US5736152A|1995-10-27|1998-04-07|Atrix Laboratories, Inc.|Non-polymeric sustained release delivery system|

---

US5797898A|1996-07-02|1998-08-25|Massachusetts Institute Of Technology|Microchip drug delivery devices|

---

EP0946193A1|1996-12-20|1999-10-06|Merck & Co., Inc.|Stabilizers for lyophilized vaccines|

---

JP3101711B2|1997-11-20|2000-10-23|農林水産省蚕糸・昆虫農業技術研究所長|Adsorbent / sustained-release body comprising biopolymer and method for producing the same|

---

EP1210064B1|1999-08-18|2005-03-09|Microchips, Inc.|Thermally-activated microchip chemical delivery devices|

---

DE60041825D1|1999-11-17|2009-04-30|Boston Scient Ltd|MINIATURIZED DEVICES FOR DISPENSING MOLECULES IN A CARRIER FLUID|

---

AU2002241834B2|2001-01-09|2006-11-09|Microchips, Inc.|Flexible microchip devices for opthalmic and other applications|

---

GB0109297D0|2001-04-12|2001-05-30|Glaxosmithkline Biolog Sa|Vaccine|

---

US20020193729A1|2001-04-20|2002-12-19|Cormier Michel J.N.|Microprojection array immunization patch and method|

---

RU21271U1|2001-08-06|2002-01-10|Алкацева Надежда Ильинична|BASIS FOR COSMETIC PRODUCTS|

---

AR040819A1|2002-08-08|2005-04-20|Alza Corp|VACCINE TRANSDERMAL ADMINISTRATION DEVICE THAT HAS MICROPROJECTIONS COVERED|

---

JP2005097229A|2002-12-04|2005-04-14|Toray Ind Inc|Method for producing vaccine and antigen protein|

---

US7842780B2|2003-01-07|2010-11-30|Trustees Of Tufts College|Silk fibroin materials and use thereof|

---

US7060260B2|2003-02-20|2006-06-13|E.I. Du Pont De Nemours And Company|Water-soluble silk proteins in compositions for skin care, hair care or hair coloring|

---

EP1613796B1|2003-04-10|2017-03-22|Tufts University|Concentrated aqueous silk fibroin solution and use thereof|

---

US7588774B2|2003-05-12|2009-09-15|Becton, Dickinson And Company|Molecules enhancing dermal delivery of influenza vaccines|

---

US20050123550A1|2003-05-12|2005-06-09|Laurent Philippe E.|Molecules enhancing dermal delivery of influenza vaccines|

---

US20050123565A1|2003-10-31|2005-06-09|Janardhanan Subramony|System and method for transdermal vaccine delivery|

---

EP1686904A4|2003-11-21|2008-02-27|Alza Corp|Ultrasound assisted transdermal vaccine delivery method and system|

---

CN1243059C|2004-03-04|2006-02-22|苏州大学|Manufacture process of nano fibroin partical|

---

GB0405787D0|2004-03-15|2004-04-21|Chiron Srl|Low dose vaccines|

---

WO2006062685A2|2004-11-11|2006-06-15|Affymax, Inc.|Novel peptides that bind to the erythropoietin receptor|

---

WO2006076711A2|2005-01-14|2006-07-20|Trustees Of Tufts College|Fibrous protein fusions and use thereof in the formation of advanced organic/inorganic composite materials|

---

AT526378T|2005-08-02|2011-10-15|Tufts College|PROCESS FOR THE STREAMLID DEPOSITION OF SILK FIBROIN COATINGS|

---

WO2008118133A2|2006-09-26|2008-10-02|Trustees Of Tufts College|Silk microspheres for encapsulation and controlled release|

---

CA2704768A1|2006-11-03|2008-10-23|Trustees Of Tufts College|Biopolymer sensor and method of manufacturing the same|

---

WO2008140562A2|2006-11-03|2008-11-20|Trustees Of Tufts College|Electroactive biopolymer optical and electro-optical devices and method of manufacturing the same|

---

US8187616B2|2007-05-29|2012-05-29|Trustees Of Tufts College|Method for silk fibroin gelation using sonication|

---

AU2008329653A1|2007-11-28|2009-06-04|Organogenesis, Inc.|Bioengineered tissue constructs and methods for production and use|

---

US8501172B2|2008-09-26|2013-08-06|Trustees Of Tufts College|pH-induced silk gels and uses thereof|

---

MX2011003618A|2008-10-09|2011-06-16|Tufts College|Modified silk films containing glycerol.|

---

US9427499B2|2008-11-17|2016-08-30|Trustees Of Tufts College|Surface modification of silk fibroin matrices with poly useful as anti-adhesion barriers and anti-thrombotic materials|

---

EP2403551A4|2009-03-04|2014-02-26|Tufts College|Silk fibroin systems for antibiotic delivery|

---

US20120070427A1|2009-06-01|2012-03-22|Trustees Of Tufts College|Vortex-induced silk fibroin gelation for encapsulation and delivery|

---

WO2011011347A2|2009-07-21|2011-01-27|Trustees Of Tufts College|Functionalization of silk material by avidin-biotin interaction|

---

IN2012DN02358A|2009-09-29|2015-08-21|Tufts College|

---

BR112013009609A2|2010-10-19|2016-07-12|Tufts College|silk fibroin microneedles and methods for making them|

---

CN102085173B|2011-01-26|2012-05-30|上海交通大学|Bioactive emulsion with natural fibroin as emulsifier and preparation method thereof|MX2011003618A|2008-10-09|2011-06-16|Tufts College|Modified silk films containing glycerol.|

---

JP2015510818A|2012-03-20|2015-04-13|トラスティーズ オブ タフツ カレッジ|Silk reservoir for drug delivery|

---

WO2013163407A1|2012-04-25|2013-10-31|Trustees Of Tufts College|Silk microspheres and methods for surface lubrication|

---

US20150368417A1|2013-02-15|2015-12-24|Tufts University|Silk-based nanoimprinting|

---

WO2014152097A1|2013-03-15|2014-09-25|Banner Pharmacaps Inc.|Silk-based capsules|

---

US10464361B2|2013-03-15|2019-11-05|Tufts University|Silk water lithography|

---

CA2905090A1|2013-03-15|2014-09-18|Trustees Of Tufts College|Low molecular weight silk compositions and stabilizing silk compositions|

---

WO2014197093A2|2013-03-15|2014-12-11|Tufts University|All water-based nanopatterning|

---

ITMI20131255A1|2013-07-26|2015-01-27|Ct Tessile Serico Societa Co Nsortile Per A|FIBROINE-BASED PHARMACEUTICAL COMPOSITIONS BASED ON FIBROIN FOR THE TREATMENT OF SKIN LESIONS|

---

WO2015034924A1|2013-09-03|2015-03-12|Georgia Tech Research Corporation|Thermally stable vaccine formulations and microneedles|

---

WO2015042462A1|2013-09-19|2015-03-26|Microvention, Inc.|Polymer films|

---

EP3052203A4|2013-09-30|2017-08-23|Silk Therapeutics Inc.|Silk protein fragment compositions and articles manufactured therefrom|

---

EP3903840A1|2014-04-04|2021-11-03|Nanofiber Solutions, LLC|Electrospun biocompatible fiber compositions|

---

CN113564927A|2014-12-02|2021-10-29|丝绸医疗公司|Silk performance garments and products and methods of making same|

---

US10213378B2|2015-03-10|2019-02-26|Sporos Therapeutics, LLC|Single dose non-adjuvanted cutaneous tetanus vaccine and uses thereof|

---

CN104940981B|2015-05-21|2018-11-30|重庆市畜牧科学院|Biologically active external application dressing and preparation method thereof|

---

CN105903027A|2016-05-31|2016-08-31|福建傲农生物科技集团股份有限公司|Method for long-term preservation of antibiotics at room temperature|

---

EP3463317A4|2016-06-07|2020-01-08|Aridis Pharmaceuticals, Inc.|Method for preparation of quick dissolving thin films containing bioactive material with enhanced thermal stability|

---

CN106362223B|2016-08-26|2019-05-03|南通纺织丝绸产业技术研究院|Porous fibroin albumen micropin drug delivery device and preparation method thereof|

---

GB201614799D0|2016-09-01|2016-10-19|Glaxosmithkline Biologicals Sa|Compositions|

---

AU2017327009A1|2016-09-19|2019-04-04|Vaxess Technologies, Inc.|Vaccine formulations with increased stability|

---

WO2018081815A2|2016-10-31|2018-05-03|Sofregen Medical, Inc.|Compositions comprising silk fibroin particles and uses thereof|

---

WO2018144858A1|2017-02-02|2018-08-09|Nanofiber Solutions, Inc.|Methods of improving bone-soft tissue healing using electrospun fibers|

---

AU2020288624A1|2019-06-04|2022-02-03|Cocoon Biotech Inc.|Silk-based products, formulations, and methods of use|

---

CN110627899A|2019-10-09|2019-12-31|山东天牧生物科技有限公司|Reovirus and parvovirus egg yolk antibody lozenge and preparation method thereof|

---

WO2021263282A1|2020-06-24|2021-12-30|Trustees Of Tufts College|Edible cell based vaccines|

法律状态:
2020-08-25| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2020-10-20| B08F| Application dismissed because of non-payment of annual fees [chapter 8.6 patent gazette]|Free format text: REFERENTE A 8A ANUIDADE. |

---

2021-02-09| B08K| Patent lapsed as no evidence of payment of the annual fee has been furnished to inpi [chapter 8.11 patent gazette]|Free format text: EM VIRTUDE DO ARQUIVAMENTO PUBLICADO NA RPI 2598 DE 20-10-2020 E CONSIDERANDO AUSENCIA DE MANIFESTACAO DENTRO DOS PRAZOS LEGAIS, INFORMO QUE CABE SER MANTIDO O ARQUIVAMENTO DO PEDIDO DE PATENTE, CONFORME O DISPOSTO NO ARTIGO 12, DA RESOLUCAO 113/2013. |

---

2021-11-03| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201161477737P| true| 2011-04-21|2011-04-21|

---

US61/477,737|2011-04-21|

---

PCT/US2012/034643|WO2012145739A1|2011-04-21|2012-04-23|Compositions and methods for stabilization of active agents|

---